ID: 1181230229

View in Genome Browser
Species Human (GRCh38)
Location 22:21417547-21417569
Sequence GCCCCTCACCTCGTGTGCGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 19 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181230229_1181230245 12 Left 1181230229 22:21417547-21417569 CCGACGCACACGAGGTGAGGGGC No data
Right 1181230245 22:21417582-21417604 CGGGGGGCGCGGGGAGCGGGCGG No data
1181230229_1181230249 19 Left 1181230229 22:21417547-21417569 CCGACGCACACGAGGTGAGGGGC No data
Right 1181230249 22:21417589-21417611 CGCGGGGAGCGGGCGGGGGCCGG No data
1181230229_1181230250 20 Left 1181230229 22:21417547-21417569 CCGACGCACACGAGGTGAGGGGC No data
Right 1181230250 22:21417590-21417612 GCGGGGAGCGGGCGGGGGCCGGG No data
1181230229_1181230248 15 Left 1181230229 22:21417547-21417569 CCGACGCACACGAGGTGAGGGGC No data
Right 1181230248 22:21417585-21417607 GGGGCGCGGGGAGCGGGCGGGGG No data
1181230229_1181230236 -6 Left 1181230229 22:21417547-21417569 CCGACGCACACGAGGTGAGGGGC No data
Right 1181230236 22:21417564-21417586 AGGGGCGGCCTTGTGGGGCGGGG No data
1181230229_1181230242 3 Left 1181230229 22:21417547-21417569 CCGACGCACACGAGGTGAGGGGC No data
Right 1181230242 22:21417573-21417595 CTTGTGGGGCGGGGGGCGCGGGG No data
1181230229_1181230244 9 Left 1181230229 22:21417547-21417569 CCGACGCACACGAGGTGAGGGGC No data
Right 1181230244 22:21417579-21417601 GGGCGGGGGGCGCGGGGAGCGGG No data
1181230229_1181230237 -5 Left 1181230229 22:21417547-21417569 CCGACGCACACGAGGTGAGGGGC No data
Right 1181230237 22:21417565-21417587 GGGGCGGCCTTGTGGGGCGGGGG No data
1181230229_1181230243 8 Left 1181230229 22:21417547-21417569 CCGACGCACACGAGGTGAGGGGC No data
Right 1181230243 22:21417578-21417600 GGGGCGGGGGGCGCGGGGAGCGG No data
1181230229_1181230234 -8 Left 1181230229 22:21417547-21417569 CCGACGCACACGAGGTGAGGGGC No data
Right 1181230234 22:21417562-21417584 TGAGGGGCGGCCTTGTGGGGCGG No data
1181230229_1181230241 2 Left 1181230229 22:21417547-21417569 CCGACGCACACGAGGTGAGGGGC No data
Right 1181230241 22:21417572-21417594 CCTTGTGGGGCGGGGGGCGCGGG No data
1181230229_1181230238 -4 Left 1181230229 22:21417547-21417569 CCGACGCACACGAGGTGAGGGGC No data
Right 1181230238 22:21417566-21417588 GGGCGGCCTTGTGGGGCGGGGGG No data
1181230229_1181230247 14 Left 1181230229 22:21417547-21417569 CCGACGCACACGAGGTGAGGGGC No data
Right 1181230247 22:21417584-21417606 GGGGGCGCGGGGAGCGGGCGGGG No data
1181230229_1181230239 1 Left 1181230229 22:21417547-21417569 CCGACGCACACGAGGTGAGGGGC No data
Right 1181230239 22:21417571-21417593 GCCTTGTGGGGCGGGGGGCGCGG No data
1181230229_1181230246 13 Left 1181230229 22:21417547-21417569 CCGACGCACACGAGGTGAGGGGC No data
Right 1181230246 22:21417583-21417605 GGGGGGCGCGGGGAGCGGGCGGG No data
1181230229_1181230252 27 Left 1181230229 22:21417547-21417569 CCGACGCACACGAGGTGAGGGGC No data
Right 1181230252 22:21417597-21417619 GCGGGCGGGGGCCGGGGCCGCGG No data
1181230229_1181230251 21 Left 1181230229 22:21417547-21417569 CCGACGCACACGAGGTGAGGGGC No data
Right 1181230251 22:21417591-21417613 CGGGGAGCGGGCGGGGGCCGGGG No data
1181230229_1181230253 28 Left 1181230229 22:21417547-21417569 CCGACGCACACGAGGTGAGGGGC No data
Right 1181230253 22:21417598-21417620 CGGGCGGGGGCCGGGGCCGCGGG No data
1181230229_1181230235 -7 Left 1181230229 22:21417547-21417569 CCGACGCACACGAGGTGAGGGGC No data
Right 1181230235 22:21417563-21417585 GAGGGGCGGCCTTGTGGGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181230229 Original CRISPR GCCCCTCACCTCGTGTGCGT CGG (reversed) Intronic