ID: 1181234967

View in Genome Browser
Species Human (GRCh38)
Location 22:21443208-21443230
Sequence GCACCCTCCTGAACTGCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 206}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181234967 Original CRISPR GCACCCTCCTGAACTGCTGT GGG Intronic
901564931 1:10106330-10106352 GCAGCCTCTGGAACTGCTGCGGG + Exonic
902613490 1:17610586-17610608 TCACCCTCCTGAGCTGCTTGGGG + Intronic
903176132 1:21582285-21582307 GAACACTTCTGCACTGCTGTTGG - Intergenic
903345659 1:22682566-22682588 GCAGCCTCCTGATTTCCTGTGGG + Intergenic
904305858 1:29589532-29589554 GTACTCTCATGAACTGCTGGTGG + Intergenic
904700190 1:32353335-32353357 GCAGCCTCCTGAACTAGAGTTGG - Intronic
906058325 1:42932628-42932650 GCAGCCTCCATCACTGCTGTTGG + Intronic
906421614 1:45673113-45673135 TCACCCCTCTGAACTGCTGAAGG - Intronic
907649654 1:56282913-56282935 GAACCCTCATGCACTGCTGTGGG - Intergenic
907849312 1:58239075-58239097 GGACCCTCCCGGAATGCTGTAGG + Intronic
914703663 1:150154507-150154529 CCATCCTTCTGAACTGCTGCTGG - Intronic
915511825 1:156390835-156390857 GCAGCCTCCTCAGATGCTGTTGG - Intergenic
915967379 1:160322719-160322741 GAACCCTCCTGCACTGTTGGTGG + Intronic
916057452 1:161077659-161077681 GCAGCCTCCTGCACAGCTGAGGG - Exonic
916199226 1:162254321-162254343 GCATCCTCCTAAACTGCTCCTGG - Intronic
917320502 1:173776045-173776067 GAACCCTCCTACACTGCTGGTGG - Intronic
922918504 1:229278825-229278847 GCCCCCACCTGAAATGATGTTGG + Intronic
1062842752 10:683775-683797 GCGCTCTCCTGAACTGCAGAGGG - Intronic
1063447593 10:6129140-6129162 GCACCCTTCAGAAATGCTTTCGG - Intergenic
1063984277 10:11484503-11484525 GCACCCAGCTGAACTGTGGTTGG - Intronic
1065181971 10:23135579-23135601 GCACCCTCCTGAACTCCCAAGGG - Intergenic
1065625686 10:27626306-27626328 GCACCCTCCTGATGTGGTGGTGG + Intergenic
1069756235 10:70775856-70775878 GCTCCCTCCTGCAGAGCTGTGGG + Intronic
1069917186 10:71794712-71794734 AAACCCTCATGCACTGCTGTAGG + Intronic
1072170425 10:92854491-92854513 GCACTCTCATACACTGCTGTGGG + Intronic
1074004677 10:109408787-109408809 GCACCCCCATGAACTACTGGTGG + Intergenic
1076901580 10:133341372-133341394 GAACCCTCCTATACTGCTGGTGG - Intronic
1078640443 11:13090453-13090475 CCTCCCTTCTGAATTGCTGTGGG + Intergenic
1078748025 11:14133908-14133930 GCACCTTCCTGGCCTGCTGAGGG - Intronic
1080441781 11:32301145-32301167 GAACCCTCCTACACTGCTGACGG + Intergenic
1080475126 11:32583482-32583504 AAACTCTCCTGTACTGCTGTTGG - Intergenic
1080971501 11:37282572-37282594 GGACACTCCTGAACAGCTGCAGG + Intergenic
1082218250 11:49601025-49601047 GCACCCTCCTGTACTATTATGGG - Intergenic
1083512274 11:63221237-63221259 GAACCCTCATGAACTGTTGGTGG - Intronic
1084493905 11:69492802-69492824 GAAGCCTCCTGGAATGCTGTGGG + Intergenic
1086631318 11:89023094-89023116 GCACCCTCCTGTACTATTATGGG + Intronic
1087076783 11:94133194-94133216 GGACCTGCGTGAACTGCTGTGGG - Intronic
1089318801 11:117611017-117611039 GCACCCTCCTGTGCTGCTGGTGG - Intronic
1090912199 11:131131113-131131135 CCACACTCCTGAGCTGCTGAAGG - Intergenic
1091697053 12:2634815-2634837 GCTCCCTTCTGAGATGCTGTGGG - Intronic
1097800348 12:63907021-63907043 GCACCCTCACATACTGCTGTGGG - Intronic
1099221518 12:79920469-79920491 GAACCCTCATGCACTGCTGGTGG - Intronic
1099827732 12:87799945-87799967 GCACCATCCTCAGCTGCTGTTGG + Intergenic
1100392021 12:94151685-94151707 TCACCCTCATTACCTGCTGTGGG - Intronic
1100926830 12:99558293-99558315 GCATCCTGCTGCACTGCTGCTGG - Intronic
1103295434 12:119882589-119882611 GATCCCTCCTAAACTGCTGGTGG + Intergenic
1103570376 12:121840662-121840684 GAACCCTCATGTACTGCTGGTGG + Intronic
1103798920 12:123524315-123524337 GAACCCTCCTACACTGCTGGTGG + Intronic
1104058007 12:125245277-125245299 CCTCCCTCCTGAACTGCAGTGGG - Intronic
1104965727 12:132508068-132508090 GCACCCACCTGAGCAGCTCTTGG - Intronic
1108058875 13:46513041-46513063 GAACCCTCCTACACTGCTGGTGG - Intergenic
1108274603 13:48794844-48794866 GCACCCTCATGAGTTGCTGATGG + Intergenic
1110980604 13:81891815-81891837 GAACCCTCATGAACTGTTGGTGG + Intergenic
1112471455 13:99693480-99693502 ACACCCTCCTTATCTGCTGTGGG + Intronic
1113060746 13:106320195-106320217 GCACCCTCGTGATGTGCTGCTGG - Intergenic
1114161815 14:20177008-20177030 ATACCCTCCTGAACTGCACTTGG - Intergenic
1115189173 14:30728679-30728701 GAACCCTCATGCACTGCTGGGGG - Intronic
1116919414 14:50557100-50557122 GCACCCTCATAAACTGCTGATGG - Intronic
1117542992 14:56766852-56766874 GAACCCTCATGCACTGCTGGTGG + Intergenic
1119746304 14:77046638-77046660 GCACCTTCCCAACCTGCTGTAGG - Intergenic
1128218334 15:65949802-65949824 GGAGCCTCCTCCACTGCTGTAGG - Intronic
1129351711 15:74959183-74959205 CCAACCTCCTAAACTGCTGTCGG + Intronic
1130123028 15:81068621-81068643 GCACCCCCCTCCACTGCTGCTGG - Intronic
1130215870 15:81968923-81968945 GAACCCTCCTACACTGCTGGTGG + Intergenic
1130575441 15:85088642-85088664 GAACCCTCCTACACTGCTGGTGG - Intronic
1131249375 15:90820433-90820455 GCACCCTCCCCAACTCCTGCTGG - Intergenic
1132788382 16:1670869-1670891 GCACTCTCCTGCACACCTGTGGG + Intronic
1138354991 16:56370465-56370487 GCACCCTCCAGAACTCCACTAGG - Intronic
1138883854 16:61050689-61050711 GCACCCTGCTGTACTGCCGCCGG - Intergenic
1139932638 16:70541055-70541077 GAACCCTCATATACTGCTGTTGG - Intronic
1141749431 16:85948299-85948321 GCATCTTCCTGAGCAGCTGTCGG + Intergenic
1142184644 16:88688728-88688750 CCGCCCTCCTGAACTGCAGCAGG + Intergenic
1142293425 16:89203035-89203057 GCACCCTTCTGTATTGCTGGTGG - Intergenic
1144434275 17:15225222-15225244 GAACCCTCCTACACTGCTGTTGG - Intergenic
1145000139 17:19299088-19299110 GCACTCTCCTTCACTGCTGGGGG - Intronic
1150501101 17:65651550-65651572 GAACACTTCTGCACTGCTGTTGG - Intronic
1151512724 17:74571109-74571131 GCAGCCTCCTGACCGGCTCTGGG + Intergenic
1152240766 17:79159813-79159835 TCACCCTCCTCAGCAGCTGTAGG - Intronic
1152630662 17:81409437-81409459 GAACCCTCCTTCACAGCTGTGGG - Intronic
1152656683 17:81523185-81523207 GCAGCTTCCCGAACTGCAGTTGG - Intronic
1155978928 18:32160761-32160783 ACACCCTCCTGAACTGTTCTGGG - Intronic
1158361101 18:56674248-56674270 GAACCCTCATGCACTGCTGATGG - Intronic
1158845340 18:61436367-61436389 GAACCCTCATGCACTGCTGATGG - Intronic
1161004945 19:1930375-1930397 TCACCCTCCTAAATTGCTGTTGG - Intergenic
1162181373 19:8871415-8871437 ACACCCTCCTGGACTGCAGTGGG + Intronic
1163463206 19:17451503-17451525 TCAGCCTCCTGAAGTGCTGGGGG + Intronic
1165491211 19:36124025-36124047 GGACCCTTCTGCACTGCTGGCGG - Intronic
1166051050 19:40260268-40260290 ACACCCTCATGCACTGCTGGTGG + Intronic
1167226258 19:48242856-48242878 GCCCCCTCCTACACTGCTGGTGG - Intronic
1167228006 19:48262465-48262487 GCCCCCTCCTACACTGCTGGTGG + Intronic
1167261059 19:48458299-48458321 GCATCCTCATACACTGCTGTGGG - Intronic
1168476701 19:56681054-56681076 GAACCCTTCTGCACTGCTGATGG - Intergenic
925852600 2:8097456-8097478 GAACCCTCCTGCCCTGCTGTGGG + Intergenic
928421487 2:31140278-31140300 GCAAGCTGCTGAGCTGCTGTTGG + Intronic
928704909 2:33939086-33939108 GCACAGTCCTGATCTGCTGAAGG - Intergenic
929325876 2:40610088-40610110 GCAGCCTCCTGAAGTGGTGCAGG + Intronic
929931201 2:46256934-46256956 GCATCCTCTTGATCTGCAGTTGG + Intergenic
930026819 2:47034187-47034209 GCAGCTTCCTGAAATCCTGTGGG + Intronic
931889975 2:66661380-66661402 GCACCCTCCTCAGCTGCAGCAGG + Intergenic
932911559 2:75811297-75811319 GAACCCTCATGCATTGCTGTTGG - Intergenic
936085636 2:109467029-109467051 GAACCCTCCTGCTCTGCTGGTGG + Intronic
936756531 2:115720145-115720167 GAACCCTCGTGCACTGCTGGTGG - Intronic
937096406 2:119238260-119238282 GAACCCTCCTACACTGCTGCTGG - Intronic
937278654 2:120702590-120702612 CCACATTCCTGACCTGCTGTGGG + Intergenic
937346373 2:121128346-121128368 GCCCTCTCCTAAACTTCTGTAGG + Intergenic
939194929 2:138960079-138960101 GAACTCTCCTAAACTGCTGGTGG - Intergenic
940610163 2:155980173-155980195 GCCCCCTCAGGAACTGCTGTAGG - Intergenic
943925577 2:193774338-193774360 GAACCCTCCTACACTGTTGTTGG + Intergenic
944295826 2:198061427-198061449 CCACCCTCCTTCACTGCTGGGGG - Intronic
945357636 2:208857923-208857945 ACACCCACATGAAGTGCTGTGGG - Intergenic
948463223 2:238140165-238140187 CCACCCTCCAGGACTGTTGTGGG + Intronic
1170297323 20:14842240-14842262 GCACCCTCCTGAATGGATGAAGG - Intronic
1171223424 20:23421147-23421169 GCGCCCTCCAGAAATCCTGTAGG - Intronic
1171818333 20:29809108-29809130 GAACCCTCGTACACTGCTGTTGG - Intergenic
1172089727 20:32421429-32421451 GAACTCTCCTCAAGTGCTGTTGG + Intronic
1172849148 20:37948044-37948066 GAACCCTCATGCACTGCTGGTGG + Intergenic
1173710811 20:45153971-45153993 GCCCTCTCATGATCTGCTGTGGG - Intergenic
1175295786 20:57907892-57907914 GCAGCCTCCTTTACTGCAGTGGG + Intergenic
1176102355 20:63370299-63370321 CCACCCTCCTGGACTCGTGTGGG + Intronic
1176195659 20:63835491-63835513 CCACCCTCCAGAGCTGCTCTGGG + Intergenic
1176948583 21:15016003-15016025 GCACCCTACTAAATAGCTGTGGG + Intronic
1178856274 21:36253041-36253063 CCACCCTCCTGAGCGCCTGTCGG + Intronic
1178901706 21:36604268-36604290 GCACCCACCTCATCTGCTGGGGG - Intergenic
1180796707 22:18609313-18609335 TCACCCTCCTGAACAGCCCTGGG - Exonic
1181225017 22:21385958-21385980 TCACCCTCCTGAACAGCCCTGGG + Exonic
1181234967 22:21443208-21443230 GCACCCTCCTGAACTGCTGTGGG + Intronic
1181253615 22:21548855-21548877 TCACCCTCCTGAACAGCCCTGGG - Exonic
1183486997 22:38093736-38093758 GAACCCTCATAAACTGCTGATGG + Intronic
949605544 3:5649195-5649217 GAACCCTCCTACACTGCTGGTGG + Intergenic
950574272 3:13822110-13822132 GAACCCTCTTGCACTGCTGGTGG + Intronic
951232432 3:20194881-20194903 GAACCCTCATGTACTGCTGGTGG - Intergenic
951642551 3:24852390-24852412 GAACCCTCATGCACTGCTGGTGG + Intergenic
951926994 3:27918579-27918601 GAACCCTCATTTACTGCTGTTGG - Intergenic
952649629 3:35709787-35709809 GCAGCCTCCTCAAATGATGTGGG + Intronic
953162178 3:40431457-40431479 GAACTCTCCTATACTGCTGTAGG + Intergenic
953211290 3:40877560-40877582 GCAGCCTTCTAAACTGCTGCTGG + Intergenic
954278246 3:49556436-49556458 GCAGACCCATGAACTGCTGTGGG + Intronic
955227366 3:57072149-57072171 GAACCCTCGTGCACTGCTGGTGG + Intronic
956165091 3:66392403-66392425 GAACCCTCCTACACTGCTGGTGG - Intronic
958695898 3:97526943-97526965 GCCCCTTCATGATCTGCTGTGGG + Intronic
960658594 3:120033431-120033453 GAACCCTCGTACACTGCTGTGGG - Intronic
961212239 3:125134673-125134695 GAACCCTCATGCACTGCTGAAGG - Intronic
962004996 3:131339820-131339842 GAACCTTCTTGAACTGGTGTAGG + Intronic
962413232 3:135159873-135159895 GCAGTCTCCTGAACTCCTCTAGG + Intronic
963363409 3:144304643-144304665 GCTCCCTCCGGATCTTCTGTGGG + Intergenic
964667489 3:159190161-159190183 GCACCCTGCTCAGCTGCAGTGGG + Intronic
964865914 3:161260583-161260605 GAACCCTCGTACACTGCTGTTGG - Intergenic
966305298 3:178526303-178526325 GCCCCCTCCTGAACACCTGAAGG + Intronic
967040843 3:185690717-185690739 GCTCTCTCCTAAACTGCTATGGG - Intronic
967532630 3:190566495-190566517 GCCCCCACCTCAAGTGCTGTTGG + Intronic
967966252 3:194962284-194962306 GCAGCCTCCAGAAGAGCTGTGGG - Intergenic
968981497 4:3852423-3852445 CCAACCTCCTGTCCTGCTGTGGG - Intergenic
975020696 4:69484182-69484204 GAACCCTCCTGTACTGCTGGTGG + Intronic
977504183 4:97880850-97880872 GCATCCTTCTGAACTGGTATTGG - Intronic
979356940 4:119715657-119715679 CCACCCTCCCCACCTGCTGTAGG - Intergenic
982771471 4:159400940-159400962 CCACCCTGCAGAACTGCTGCTGG + Intergenic
984186984 4:176556960-176556982 GCACAGTCTTGCACTGCTGTTGG - Intergenic
984206976 4:176797145-176797167 GCACTCTCCCTTACTGCTGTAGG + Intergenic
990559805 5:56972606-56972628 GAACCCTCATGCACTGCTGGTGG + Intergenic
990962337 5:61407881-61407903 GCATCCTCCTGCACTGCTGGTGG + Intronic
991908153 5:71533388-71533410 GAACCCTCATAAACTGCTGGTGG - Intronic
994016442 5:94972173-94972195 GCACCCACAAGCACTGCTGTGGG + Intronic
997235599 5:132270483-132270505 TCACCTTCCTGAACTGTGGTGGG - Intronic
997308577 5:132859855-132859877 GAACCCTCGTGCACTGCTGGTGG + Intergenic
997470741 5:134115484-134115506 GCCGCCTCCTGAGCTGCGGTGGG - Intronic
999055858 5:148575473-148575495 GAACCATTATGAACTGCTGTGGG + Intronic
999650026 5:153756227-153756249 GCCCCCTCTGGATCTGCTGTGGG - Intronic
1000265380 5:159631363-159631385 GCACCCTCATGCACTGTTGGTGG - Intergenic
1002536132 5:179876703-179876725 GAACCCTTGTGAACTGCTGGTGG + Intronic
1005596790 6:27387233-27387255 GAACCCTCCTGCACTGCTGATGG + Intronic
1005933493 6:30500735-30500757 GCATCCTCCAGAACAGCAGTAGG - Intergenic
1006018079 6:31098639-31098661 GCACTCTCATGCACAGCTGTTGG + Intergenic
1006829795 6:36961864-36961886 GCATCCTCCTGACCTCCTGTAGG + Exonic
1007045338 6:38767910-38767932 GAACCCTCCTGCATTGCTGGTGG - Intronic
1008907385 6:56694773-56694795 GCTCCCTCATGAACGGCTTTCGG + Intronic
1009824086 6:68844522-68844544 GAACCATCCTGAACTGTTGGTGG + Intronic
1011679474 6:89768934-89768956 TCAGCCTCCTGAGCAGCTGTGGG - Intronic
1014095722 6:117458464-117458486 GCAACCTTCTGCACTGCTGGAGG - Intronic
1017219339 6:151948427-151948449 GCAGCCTCATGAACTGCTGCTGG + Intronic
1018836094 6:167485335-167485357 GCACACTCCTGTACTGGGGTTGG - Intergenic
1019107630 6:169681941-169681963 GCCCCCTTATGATCTGCTGTGGG - Intronic
1020287778 7:6698608-6698630 GCTGCATTCTGAACTGCTGTAGG - Intronic
1023648925 7:42348341-42348363 GCAAGATCCTGTACTGCTGTGGG - Intergenic
1026967199 7:74447840-74447862 ACACACTCCTGGGCTGCTGTGGG + Intergenic
1027187294 7:75980043-75980065 GCAGCCTCCTGAGCTGATGCAGG - Intronic
1027845912 7:83374341-83374363 GAACCCACATGAACTGCTTTGGG + Intronic
1029714977 7:102320744-102320766 ACACCCACCTGCACTGCTGTTGG - Intronic
1029842170 7:103376594-103376616 CAACCCTCCTGAACTGGAGTTGG - Intronic
1034386536 7:150745280-150745302 GCATCCTCCAGCACTGCTGCTGG - Intronic
1034740526 7:153469350-153469372 GCACTCTCCTACACTGCTGGTGG - Intergenic
1035000202 7:155606507-155606529 GCACCCTCCCACACTGCTGGTGG + Intergenic
1036155408 8:6337671-6337693 AAACCCTCATGAACTGCTGGTGG + Intergenic
1037694421 8:21210942-21210964 GCATCCTCCTGTTCTGCTGCCGG + Intergenic
1037959210 8:23083894-23083916 GAACCCTCCTGAGAGGCTGTGGG - Intergenic
1038522919 8:28248667-28248689 GCCCCGGCCTGAACTTCTGTCGG - Intergenic
1038724866 8:30072065-30072087 GAACCCTCATACACTGCTGTTGG - Intronic
1040478834 8:47805245-47805267 GAACCCTTCTGCACTGCTGGTGG - Intronic
1040905941 8:52469919-52469941 GAACCCTCCTGACCTGCTCTAGG - Intergenic
1042094780 8:65201957-65201979 GAACCCTCCTATACTGCTGGTGG - Intergenic
1042689128 8:71477602-71477624 GCACCCTCATGTATTGCAGTGGG + Intronic
1043606479 8:82006798-82006820 GCACTCCCATGAACAGCTGTGGG + Intergenic
1044925888 8:97208460-97208482 GCACCCTCCTGAAGTGACCTGGG - Intergenic
1045004489 8:97906147-97906169 GAACCCTCGTGTACTGCTGGTGG - Intronic
1045281859 8:100756363-100756385 GCATCCGTCTGAACTGCTGCTGG + Intergenic
1046249411 8:111610374-111610396 TCAGCCTCCTGAAGTGCTCTTGG - Intergenic
1046498665 8:115046740-115046762 GAACACTTCTGCACTGCTGTTGG + Intergenic
1047459474 8:125048569-125048591 GAACCCTCGTACACTGCTGTTGG + Intronic
1049100500 8:140575346-140575368 GCACCTCCCTGACCTGCTCTGGG + Intronic
1049370862 8:142265707-142265729 GCTCGCTCATGCACTGCTGTTGG - Intronic
1049727045 8:144151878-144151900 GCACCGTGCTGCACTGCCGTCGG + Intronic
1051478736 9:17537078-17537100 CCACCCTCCTTAACTACTGTGGG - Intergenic
1056547668 9:87626485-87626507 GCAACTTCATGAACTGCTGCTGG + Intronic
1057882338 9:98801982-98802004 GCTCCCTACTGAGTTGCTGTGGG - Intergenic
1058326833 9:103708891-103708913 GCACCCCTCTCAACTGTTGTAGG - Intergenic
1060110338 9:120902268-120902290 GCACCTTCGGGAACTGCTGGGGG + Intergenic
1062254449 9:135614470-135614492 TCACCCTCCAGAGCTGCTGCAGG - Intergenic
1186515056 X:10160828-10160850 TCACCCTGCAGAGCTGCTGTCGG + Intronic
1189233437 X:39469957-39469979 GCAGCCTCCTAGACTGCGGTGGG - Intergenic
1190469945 X:50768979-50769001 TCACCCTCCTGGCCTGCTGCTGG - Intronic
1192225613 X:69225733-69225755 GAACCCTCCTGCATTGCTGGTGG + Intergenic
1193449428 X:81647362-81647384 GCACACTCATCAGCTGCTGTAGG + Intergenic
1196119127 X:112029605-112029627 GAACCCTCTTGCACTGCTGGTGG - Intronic
1197007280 X:121516453-121516475 GAACCCTCCTCCATTGCTGTTGG + Intergenic
1197391497 X:125872176-125872198 GAACCCTCCTAAACTGTTGGTGG - Intergenic
1198171643 X:134111928-134111950 GAACCCTCGTGCACTGCTGGTGG - Intergenic
1198513922 X:137384922-137384944 GAACCCTCATGCACTGCTGGTGG + Intergenic
1200055630 X:153458703-153458725 GAACCCTTCTGCATTGCTGTAGG - Intronic
1200218815 X:154380610-154380632 ACACCCTCCTGAATGGCTCTGGG - Intronic