ID: 1181235400

View in Genome Browser
Species Human (GRCh38)
Location 22:21445375-21445397
Sequence CCGTGGACAGCCGCTGGCTG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 145}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181235400_1181235410 13 Left 1181235400 22:21445375-21445397 CCGCAGCCAGCGGCTGTCCACGG 0: 1
1: 0
2: 1
3: 9
4: 145
Right 1181235410 22:21445411-21445433 AGCTCGGTATCAGGGGCTCGTGG 0: 1
1: 0
2: 0
3: 1
4: 52
1181235400_1181235416 28 Left 1181235400 22:21445375-21445397 CCGCAGCCAGCGGCTGTCCACGG 0: 1
1: 0
2: 1
3: 9
4: 145
Right 1181235416 22:21445426-21445448 GCTCGTGGATGGGCGCAAGGGGG 0: 1
1: 0
2: 0
3: 3
4: 82
1181235400_1181235414 26 Left 1181235400 22:21445375-21445397 CCGCAGCCAGCGGCTGTCCACGG 0: 1
1: 0
2: 1
3: 9
4: 145
Right 1181235414 22:21445424-21445446 GGGCTCGTGGATGGGCGCAAGGG 0: 1
1: 0
2: 0
3: 10
4: 116
1181235400_1181235415 27 Left 1181235400 22:21445375-21445397 CCGCAGCCAGCGGCTGTCCACGG 0: 1
1: 0
2: 1
3: 9
4: 145
Right 1181235415 22:21445425-21445447 GGCTCGTGGATGGGCGCAAGGGG 0: 1
1: 0
2: 1
3: 0
4: 68
1181235400_1181235406 4 Left 1181235400 22:21445375-21445397 CCGCAGCCAGCGGCTGTCCACGG 0: 1
1: 0
2: 1
3: 9
4: 145
Right 1181235406 22:21445402-21445424 TGTCATCCAAGCTCGGTATCAGG 0: 1
1: 0
2: 0
3: 1
4: 48
1181235400_1181235408 6 Left 1181235400 22:21445375-21445397 CCGCAGCCAGCGGCTGTCCACGG 0: 1
1: 0
2: 1
3: 9
4: 145
Right 1181235408 22:21445404-21445426 TCATCCAAGCTCGGTATCAGGGG 0: 1
1: 0
2: 0
3: 6
4: 93
1181235400_1181235407 5 Left 1181235400 22:21445375-21445397 CCGCAGCCAGCGGCTGTCCACGG 0: 1
1: 0
2: 1
3: 9
4: 145
Right 1181235407 22:21445403-21445425 GTCATCCAAGCTCGGTATCAGGG 0: 1
1: 0
2: 0
3: 1
4: 41
1181235400_1181235412 18 Left 1181235400 22:21445375-21445397 CCGCAGCCAGCGGCTGTCCACGG 0: 1
1: 0
2: 1
3: 9
4: 145
Right 1181235412 22:21445416-21445438 GGTATCAGGGGCTCGTGGATGGG 0: 1
1: 0
2: 0
3: 4
4: 122
1181235400_1181235413 25 Left 1181235400 22:21445375-21445397 CCGCAGCCAGCGGCTGTCCACGG 0: 1
1: 0
2: 1
3: 9
4: 145
Right 1181235413 22:21445423-21445445 GGGGCTCGTGGATGGGCGCAAGG 0: 1
1: 0
2: 0
3: 16
4: 185
1181235400_1181235404 -3 Left 1181235400 22:21445375-21445397 CCGCAGCCAGCGGCTGTCCACGG 0: 1
1: 0
2: 1
3: 9
4: 145
Right 1181235404 22:21445395-21445417 CGGCCTCTGTCATCCAAGCTCGG 0: 1
1: 0
2: 5
3: 35
4: 501
1181235400_1181235411 17 Left 1181235400 22:21445375-21445397 CCGCAGCCAGCGGCTGTCCACGG 0: 1
1: 0
2: 1
3: 9
4: 145
Right 1181235411 22:21445415-21445437 CGGTATCAGGGGCTCGTGGATGG 0: 1
1: 0
2: 0
3: 7
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181235400 Original CRISPR CCGTGGACAGCCGCTGGCTG CGG (reversed) Exonic
900518754 1:3095689-3095711 CCGTGGGCAGCCTCTGGCCTCGG + Intronic
900655525 1:3754945-3754967 CCGTGGAGACCCTCTTGCTGAGG - Intronic
900933302 1:5750293-5750315 CAGCGGTCAGCCGCAGGCTGCGG - Intergenic
902611047 1:17597359-17597381 CCATGGACAGCGGCTGGGAGAGG + Intronic
904468435 1:30721497-30721519 CTGTGGACAGCGGCTGGATACGG + Exonic
906053105 1:42891038-42891060 CAGGGGACAGCTGCTGTCTGGGG + Intergenic
906535562 1:46549228-46549250 CCGTGGTCTGCCCCTGGATGGGG + Exonic
918732298 1:188013524-188013546 CCCTCCACAGCCGCTGGCCGAGG + Intergenic
920039358 1:203085607-203085629 CCTTGGGCAGCCGCTGGTTGGGG + Exonic
1063522074 10:6750187-6750209 GTGTGGACAGATGCTGGCTGAGG - Intergenic
1066037592 10:31508830-31508852 CCATCCACAGCCGCTGTCTGGGG - Intronic
1068507275 10:57917295-57917317 CAGTGAACAGCTGCTGACTGAGG - Intergenic
1069714807 10:70513908-70513930 CCAGGGACCGCTGCTGGCTGCGG + Intronic
1073500942 10:103936372-103936394 CCCAGGACAGGAGCTGGCTGGGG + Intergenic
1074776454 10:116771294-116771316 CCATCAGCAGCCGCTGGCTGTGG + Intergenic
1074780174 10:116796789-116796811 CCAAGGACAGCCCCAGGCTGAGG + Intergenic
1075381068 10:122019083-122019105 CTGCGGACAGCCGGAGGCTGCGG + Intronic
1076267710 10:129121816-129121838 CTGTGGCCAGCAGCTGGGTGTGG - Intergenic
1076374412 10:129973430-129973452 CCGTGGGCAGGAGATGGCTGGGG + Intergenic
1076563188 10:131380966-131380988 CCCAGGACAGCAGCTGCCTGGGG + Intergenic
1076899301 10:133329252-133329274 TCGTGGACAGTCACTGGTTGGGG - Intronic
1077256592 11:1586867-1586889 GGTTGGACAGCAGCTGGCTGGGG - Intergenic
1077535079 11:3120166-3120188 TCCTGGACAGCAGCTGGGTGAGG + Intronic
1079416123 11:20238103-20238125 CCATGGACAGACGGGGGCTGGGG + Intergenic
1081575174 11:44314691-44314713 CAGAGGACTGCCCCTGGCTGGGG + Intergenic
1081799299 11:45847199-45847221 CCGCGGACAGCCCCAGCCTGCGG + Intronic
1081867288 11:46366814-46366836 CTGAGGGCCGCCGCTGGCTGAGG - Exonic
1089853141 11:121517523-121517545 CCATTGAAAGCCCCTGGCTGTGG + Intronic
1090716521 11:129436667-129436689 CTGCGGAGGGCCGCTGGCTGAGG - Intronic
1092256664 12:6929575-6929597 CCAAGGACAGCCACAGGCTGAGG - Intronic
1099285182 12:80708088-80708110 CCTTGGGCAGCCTCTGGTTGGGG - Exonic
1099286337 12:80717402-80717424 CCTTGGGCAGCCTCTGGTTGGGG - Exonic
1102256007 12:111415378-111415400 CCGTGGACAGCAGAGGGGTGGGG + Intronic
1105038848 12:132946363-132946385 CCCTGGGCAGACGCAGGCTGGGG + Intronic
1105926229 13:25011298-25011320 CCGTGGCCTGCCCGTGGCTGTGG - Intergenic
1113879012 13:113612315-113612337 CCGGGGACAGCAGGAGGCTGGGG - Intronic
1113902291 13:113803948-113803970 CCGTGGCCAGCCCCTCGCAGCGG + Intronic
1118849841 14:69574675-69574697 CCATGGAGAGACGCTGGCGGCGG - Exonic
1120981978 14:90298332-90298354 CAGTGGAGAGCCCCGGGCTGGGG - Exonic
1122793740 14:104195393-104195415 CCGGGGACACCCAATGGCTGTGG - Intergenic
1122885558 14:104708888-104708910 GCCTGGACAGCCCCTAGCTGGGG - Intronic
1122974412 14:105165211-105165233 CAGGGGACACCTGCTGGCTGAGG - Intronic
1123005829 14:105323329-105323351 CAGTGGGCGGCGGCTGGCTGGGG + Intronic
1123055083 14:105565837-105565859 CCCCGGACAGCCCCTGGGTGTGG + Intergenic
1123079531 14:105685681-105685703 CCCCGGACAGCCCCTGGGTGTGG + Intergenic
1125520758 15:40346726-40346748 TCGTGGACAGCTGTGGGCTGGGG - Intergenic
1125524828 15:40368284-40368306 GCGTGGGCAGCCGCAGGCGGGGG - Exonic
1130302228 15:82688911-82688933 CCATGGACCGCAGCTGGCTGGGG - Intronic
1132426734 15:101724310-101724332 AGGAGGACATCCGCTGGCTGTGG - Exonic
1132629072 16:908075-908097 CTGTGGACAGCAGCCGGGTGGGG - Intronic
1133734924 16:8607673-8607695 CCATGGCCAGCCGCTGCCTGGGG + Intergenic
1136629134 16:31479184-31479206 CCCTGGAGAGCCCCAGGCTGAGG + Intergenic
1141422295 16:83925050-83925072 CCGGGGACAGGCCCTGTCTGGGG + Exonic
1143844421 17:9763087-9763109 CCGAGGAGAGCCACTGGCTCTGG - Intergenic
1145868465 17:28255629-28255651 CCGTGGAGAGCAGCTGGCCTAGG + Intergenic
1145980100 17:29006030-29006052 CCGTCGCCAGGCGCTGGCCGTGG - Exonic
1147443664 17:40462240-40462262 CTGTGGACAGCCTCTCACTGAGG + Intergenic
1147653420 17:42074813-42074835 CCGTGGACAGCCACAGGATGTGG - Intergenic
1148178448 17:45586485-45586507 CTGTGGAGAGCAGGTGGCTGTGG + Intergenic
1148270712 17:46259970-46259992 CTGTGGAGAGCAGGTGGCTGTGG - Intergenic
1148341113 17:46874041-46874063 CCGTGGAGAGCAGCTGGCCTAGG - Intronic
1150216636 17:63475161-63475183 GCGAGGCCAGCCTCTGGCTGAGG + Intergenic
1153466556 18:5394781-5394803 CCGGGGATAGGCGCTGGCTCAGG - Exonic
1153847508 18:9063113-9063135 CCGTGGACAGCTGGTGGAGGGGG - Intergenic
1156629059 18:38944624-38944646 CCCTCCACAGCTGCTGGCTGGGG + Intergenic
1160015112 18:75134208-75134230 CCGTGCAGAGCCCCTGCCTGGGG - Intergenic
1160408301 18:78658231-78658253 CTGTGGACAGCTGCGGCCTGGGG - Intergenic
1160760550 19:782098-782120 CCGCTGACAGCCGCAGGGTGTGG - Intergenic
1161281429 19:3447798-3447820 CCCTGGAAAGCCCCTGGGTGTGG - Intronic
1166208556 19:41289999-41290021 CCATGGAGAGCGGCTGGATGTGG - Intronic
1167145733 19:47680130-47680152 CTCGGGACAGCCGCTGGCGGTGG + Exonic
1167643300 19:50693617-50693639 CCGTGCACAGCAGCAGGCTCTGG - Intronic
925853921 2:8111051-8111073 CTGTGGAAAGCAGCAGGCTGGGG + Intergenic
926716524 2:15928579-15928601 CCCTGGACAGCATCTGGCGGAGG + Intergenic
929762980 2:44821281-44821303 CCTTGGACACCCTCTGCCTGGGG + Intergenic
932836833 2:75045938-75045960 CCGTGCTCAGCCGCTGGCTGGGG - Intergenic
937258909 2:120573026-120573048 CCGTGGGAAGCAGCAGGCTGGGG + Intergenic
942246448 2:174013039-174013061 CCCTGGGAAGTCGCTGGCTGAGG - Intergenic
943564831 2:189505141-189505163 CCATGGACACCTGCAGGCTGAGG + Intergenic
946368592 2:219266538-219266560 GCCTGGACAGGGGCTGGCTGGGG - Intronic
947729260 2:232419118-232419140 CCTTGTACAGCAGCTGGTTGAGG + Intergenic
948166052 2:235863583-235863605 CAGGGGACAGACGCTGGCTGGGG + Intronic
948330656 2:237161730-237161752 ACGTGGACAGCAGCTGCCAGAGG + Intergenic
948421625 2:237863871-237863893 CAGTGGACAGCCGGGGCCTGGGG - Intronic
948712747 2:239835237-239835259 CCCTGGCCAGCCGTTGGGTGTGG - Intergenic
1175186940 20:57185062-57185084 CCCTGGAGAGCCGATGGCAGGGG + Intronic
1175551989 20:59823221-59823243 CCGTGGACAGTGGCTGACTCCGG - Intronic
1176296325 21:5075350-5075372 ACCTGGACATCAGCTGGCTGAGG - Intergenic
1179408041 21:41141346-41141368 CCTTGCACAGCCTCTGCCTGTGG - Intergenic
1179617924 21:42593728-42593750 CCGGGGACAGGGGCTGGCCGAGG + Intergenic
1179802272 21:43816624-43816646 TCGTGGACAGAGGCTGTCTGGGG - Intergenic
1179860724 21:44186771-44186793 ACCTGGACATCAGCTGGCTGAGG + Intergenic
1180955324 22:19738832-19738854 CCAGGGCCAGCCGCTGGCTCGGG + Intergenic
1181235400 22:21445375-21445397 CCGTGGACAGCCGCTGGCTGCGG - Exonic
1181478194 22:23181249-23181271 CCGTCGGCGGGCGCTGGCTGCGG - Exonic
1183736591 22:39648082-39648104 CCGTGGACGGCCACGTGCTGGGG - Intronic
1184106300 22:42369221-42369243 CCGTGGCCAGCGGCCGGCCGCGG - Intergenic
1184783998 22:46663044-46663066 GCGAGGACAGCCCCTGGCTCCGG - Exonic
1185016554 22:48346520-48346542 CCATGGGGAGACGCTGGCTGGGG + Intergenic
1185211708 22:49574247-49574269 CCGTGTCCACCCGCTGGCCGTGG - Intronic
949549387 3:5099640-5099662 TGGTGGACAGGCGCAGGCTGGGG + Intergenic
950188303 3:10958856-10958878 ACATGGCCAGCCGCTGGCTCAGG - Intergenic
951908804 3:27728947-27728969 CCCTCGACAGCCGCTCTCTGCGG - Intergenic
952840796 3:37643676-37643698 CGGTGGACAGTGTCTGGCTGGGG + Intronic
952897651 3:38088861-38088883 CAGTGGTCTGCCCCTGGCTGTGG + Intronic
953451009 3:43006216-43006238 CGGTGCACAGCCGTTGGCTTAGG + Intronic
958929226 3:100191198-100191220 CTGTGCTCAGCCACTGGCTGAGG - Intronic
961805672 3:129487747-129487769 CCGTGCACAGCCGTGGGCAGTGG - Intronic
967946150 3:194805751-194805773 CCGTGGACTGGCTCTGCCTGTGG + Intergenic
968081477 3:195849536-195849558 CCGCAGCCAGCCGCTGCCTGGGG - Intergenic
968488623 4:877512-877534 CCGGGGACAGGCGCTTGCTGAGG - Intronic
968515203 4:1012716-1012738 CTGTGGACAGCCCATGGGTGAGG - Intronic
969217645 4:5734998-5735020 CTGTGGACACTCGCTGGCTGTGG - Intronic
973894287 4:55396352-55396374 CCCTGCACAGCCACAGGCTGCGG - Exonic
977323840 4:95549893-95549915 CCCAGGACAGCAGCCGGCTGGGG - Intergenic
992151778 5:73911503-73911525 CTGTGGACAGCCGCTGGTTCCGG + Exonic
992777686 5:80102779-80102801 CTGTGGACAGCCCCTGAGTGAGG - Intergenic
997680412 5:135746282-135746304 AAGTGCACAGCCGCTGGTTGGGG + Intergenic
998266597 5:140671715-140671737 CTGTGGAGAGCAGGTGGCTGTGG - Exonic
1006921988 6:37633329-37633351 CCCTGCAGAGCCACTGGCTGAGG - Exonic
1007459530 6:42007968-42007990 CTGGGGACAGCAGCTGGCGGGGG + Intronic
1008270492 6:49483637-49483659 CCCTCCACAGCCGCTGGCTTGGG + Intronic
1011515077 6:88144917-88144939 CAATGGCCAGCTGCTGGCTGGGG + Exonic
1015148791 6:130017194-130017216 CGTTGAACAGCCGTTGGCTGAGG - Intronic
1020422645 7:8026696-8026718 CCATGCACAGGCACTGGCTGAGG - Intronic
1021541770 7:21767452-21767474 CCGTTGACATCTGCTGGATGAGG + Intronic
1024212213 7:47215774-47215796 CCGTGGACAGCTGAGGCCTGAGG + Intergenic
1024544102 7:50502597-50502619 TCGTGCACAGCCCCGGGCTGGGG - Intronic
1024700636 7:51901115-51901137 CCGTCCGCAGCCGCTGGCTTGGG + Intergenic
1029437250 7:100570138-100570160 CCCAGGGCAGCGGCTGGCTGAGG - Intergenic
1033336176 7:140454461-140454483 CAGGGGACAGCTGCTGTCTGAGG + Exonic
1036595164 8:10205333-10205355 AGGGGGACAGTCGCTGGCTGTGG + Intronic
1037805860 8:22057612-22057634 GCCTGGCCAGCCACTGGCTGGGG - Intronic
1041977393 8:63815775-63815797 CCCAGGACAGCAGCAGGCTGGGG - Intergenic
1049236888 8:141516779-141516801 CCGTGGACAGCGCCATGCTGGGG - Intronic
1049419859 8:142511676-142511698 CTGGGGTCAGCCGCTGGCAGGGG + Intronic
1051151241 9:14081405-14081427 CCGGGGACACCCTGTGGCTGTGG - Intergenic
1053890963 9:42692653-42692675 CCGGGGAGAGCCGCTTGCTCAGG - Intergenic
1054220736 9:62409106-62409128 CCGGGGAGAGCCGCTTGCTCAGG + Intergenic
1054229978 9:62500066-62500088 CCGGGGAGAGCCGCTTGCTCAGG - Intergenic
1055611802 9:78031667-78031689 CCGTCGGCGGCCGCTCGCTGCGG - Intergenic
1056828030 9:89890384-89890406 CCCTGGACAGACGCGGGCCGAGG + Intergenic
1056841239 9:89999584-89999606 CTGTGCACAGGAGCTGGCTGAGG + Intergenic
1057632032 9:96727277-96727299 CAGGGGACAGCTGCTGTCTGGGG - Intergenic
1058937114 9:109779943-109779965 GCGTGGACACGCGCTTGCTGGGG - Intronic
1058995130 9:110292185-110292207 GCGTGGGCAGCCGGGGGCTGTGG - Intergenic
1061537202 9:131257602-131257624 CCCTCAACAGCTGCTGGCTGAGG + Intergenic
1062127165 9:134870059-134870081 CCGTGGACAGCCCCTGGGCTAGG + Intergenic
1062617623 9:137405134-137405156 CTTTGGACACCCGCTGGCAGAGG - Intronic
1186872203 X:13784149-13784171 CAGTGGGCAGCCGAAGGCTGAGG - Intronic
1188625202 X:32276143-32276165 CCGTGCACAGGCACTGACTGAGG - Intronic
1188757940 X:33987425-33987447 CCATGCACAGCTGCTGTCTGGGG - Intergenic
1192547544 X:72026558-72026580 CCTGGGACAGCCTCTGGCTGTGG - Intergenic
1192767862 X:74161004-74161026 CAGGGGACAGCTGCTGTCTGGGG + Intergenic
1195094248 X:101490347-101490369 CTGTGGTCAGCCCCTGGTTGTGG + Exonic
1199319623 X:146422939-146422961 CCCTGGTCACCTGCTGGCTGTGG - Intergenic