ID: 1181236031

View in Genome Browser
Species Human (GRCh38)
Location 22:21448172-21448194
Sequence CAGGGGAACCATGAGGAGGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 369
Summary {0: 1, 1: 0, 2: 4, 3: 31, 4: 333}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181236021_1181236031 6 Left 1181236021 22:21448143-21448165 CCAGCCTGGAGCCAGGCACTGGG 0: 1
1: 2
2: 11
3: 126
4: 752
Right 1181236031 22:21448172-21448194 CAGGGGAACCATGAGGAGGGTGG 0: 1
1: 0
2: 4
3: 31
4: 333
1181236018_1181236031 8 Left 1181236018 22:21448141-21448163 CCCCAGCCTGGAGCCAGGCACTG 0: 1
1: 1
2: 14
3: 55
4: 546
Right 1181236031 22:21448172-21448194 CAGGGGAACCATGAGGAGGGTGG 0: 1
1: 0
2: 4
3: 31
4: 333
1181236023_1181236031 2 Left 1181236023 22:21448147-21448169 CCTGGAGCCAGGCACTGGGTGCT 0: 1
1: 0
2: 4
3: 92
4: 1870
Right 1181236031 22:21448172-21448194 CAGGGGAACCATGAGGAGGGTGG 0: 1
1: 0
2: 4
3: 31
4: 333
1181236025_1181236031 -5 Left 1181236025 22:21448154-21448176 CCAGGCACTGGGTGCTGACAGGG 0: 1
1: 0
2: 2
3: 26
4: 312
Right 1181236031 22:21448172-21448194 CAGGGGAACCATGAGGAGGGTGG 0: 1
1: 0
2: 4
3: 31
4: 333
1181236019_1181236031 7 Left 1181236019 22:21448142-21448164 CCCAGCCTGGAGCCAGGCACTGG 0: 1
1: 0
2: 9
3: 83
4: 595
Right 1181236031 22:21448172-21448194 CAGGGGAACCATGAGGAGGGTGG 0: 1
1: 0
2: 4
3: 31
4: 333

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181236031 Original CRISPR CAGGGGAACCATGAGGAGGG TGG Exonic
900180669 1:1309648-1309670 CAGGGTGACCGTCAGGAGGGTGG - Intronic
900427014 1:2585539-2585561 AAGGGGAAGCACTAGGAGGGAGG - Intergenic
900796351 1:4710978-4711000 CTGCGCAACCCTGAGGAGGGCGG - Intronic
900850010 1:5135398-5135420 GAGGTGAATAATGAGGAGGGTGG - Intergenic
901536066 1:9883667-9883689 CAGGAGGACCATGAGGAGGGAGG - Intronic
901962529 1:12838716-12838738 CAGGGGGACCCTGAGTTGGGGGG + Intergenic
902816516 1:18919413-18919435 CAGGGGAGCCCGGGGGAGGGCGG + Intronic
902839340 1:19065346-19065368 CAGGGTAACCGGGAGGAGGACGG + Intergenic
902959638 1:19953905-19953927 CAGGGGAATCAGATGGAGGGAGG + Intergenic
903213958 1:21833033-21833055 CAGAGGAGCCACGAGGAGGCTGG + Intronic
903974056 1:27137833-27137855 CAGGGGCACATTGGGGAGGGAGG - Intronic
904493921 1:30876482-30876504 CAGGGGAGGGATGAGGAGGATGG - Intronic
905120664 1:35679428-35679450 CAGAGAAGCCAGGAGGAGGGAGG - Intergenic
905417703 1:37815660-37815682 CATGGGAACCATGGGAAGGATGG + Intronic
905798611 1:40829504-40829526 CAGGGGCACCTTCAGGAAGGTGG - Intronic
906323079 1:44828542-44828564 GAGGGCAGCCATGAGGAAGGCGG + Exonic
907087962 1:51695459-51695481 CAGTGGAACCATGAGGTAGTTGG + Intronic
907309493 1:53531149-53531171 CAGGTGACCCTTGAGGAGGAAGG + Intronic
907328072 1:53653809-53653831 CAGGAGATGCATGGGGAGGGCGG - Intronic
908780967 1:67689347-67689369 CAGGGGAGCCATAAGGGGGACGG - Intergenic
909359720 1:74746146-74746168 CAGGGGAGCCATGTGGACTGAGG + Intronic
910653245 1:89592575-89592597 CAGGAGTACAATGAGGAGTGAGG - Intronic
912550539 1:110482762-110482784 CAGAGGAACCCTGAGGAGATGGG - Intergenic
912699187 1:111863846-111863868 CAGGGGAGAAATGATGAGGGGGG + Intronic
915267118 1:154726847-154726869 CAGGGGAGCCCGGGGGAGGGTGG + Intronic
915488727 1:156239890-156239912 CTGGGGAACCAGCAGGAGGGGGG - Intronic
915702285 1:157807304-157807326 CAGGGGTAAGATAAGGAGGGAGG - Intronic
915771220 1:158426985-158427007 CAGTTGAACCATGAGGAAAGTGG - Intergenic
917975833 1:180237089-180237111 CAGGGGAAGGAGAAGGAGGGAGG - Intronic
920498408 1:206471263-206471285 CAGCAGAGCCCTGAGGAGGGAGG + Intronic
920531913 1:206708275-206708297 CAGGGGAAACAAGAGGTGGCTGG - Intronic
921009694 1:211129014-211129036 CTGGAGAACCATCAGGAGGGAGG + Intronic
921151530 1:212406921-212406943 CAGGAGAAAGAAGAGGAGGGAGG - Intronic
922190735 1:223316448-223316470 CATGGGAACCTGGAGGAAGGGGG + Intronic
923106052 1:230854788-230854810 CAGGAGACCTATGAGGAGGGTGG - Intronic
923267372 1:232327768-232327790 TTGGGGAACAATAAGGAGGGAGG - Intergenic
924852601 1:247845322-247845344 CAGTGGATCCAGGAAGAGGGAGG - Intergenic
1062952276 10:1513618-1513640 CAGGGCAGCCCTGAGGAGAGGGG + Intronic
1062975027 10:1676834-1676856 CAGGGGAAGCATGAAGAGGATGG + Intronic
1063445564 10:6112449-6112471 CAGGGGGACAATGAGGCGTGTGG + Intronic
1063605384 10:7518824-7518846 CTGTGGAAGCCTGAGGAGGGAGG + Intergenic
1064136056 10:12751792-12751814 CAGGGAAGCCATGTGGTGGGCGG + Intronic
1065168600 10:23005950-23005972 CTGGGGAGCCCTGAGGTGGGCGG + Intronic
1066237714 10:33502500-33502522 GAGATGAACTATGAGGAGGGAGG - Intergenic
1067058697 10:43066712-43066734 CTTGGGAACCATGAGCAGGGTGG + Intergenic
1069556007 10:69399080-69399102 AAGGGGGACCAGGAGGAGTGGGG - Intronic
1070630919 10:78084064-78084086 CTGGGGAACCAGGATGAGGGTGG + Intergenic
1070696004 10:78563558-78563580 CAGGGGTACCGTGAGGGAGGTGG - Intergenic
1070828306 10:79403855-79403877 CAGGAAAACCCTGGGGAGGGGGG + Intronic
1070872729 10:79771928-79771950 CAAGGAACCCAAGAGGAGGGTGG - Intergenic
1071499136 10:86191264-86191286 CAGGGGAACAAGGAGAAGAGAGG + Intronic
1071549704 10:86557173-86557195 CAGGGGAAGCCAGAGGAGGAAGG + Intergenic
1071639652 10:87294077-87294099 CAAGGAACCCAAGAGGAGGGTGG - Intergenic
1071655583 10:87443875-87443897 CAAGGAACCCAAGAGGAGGGTGG + Intergenic
1073503519 10:103964556-103964578 GAGGGTAACTATGAGTAGGGGGG + Intergenic
1073586018 10:104710850-104710872 CATGTGAAGCATGAGGAGGAGGG + Intronic
1074439551 10:113464132-113464154 CAGAGAACCCAAGAGGAGGGAGG + Intergenic
1074455970 10:113595317-113595339 CTGGGTAACCATGAGGGGAGTGG - Intronic
1074715169 10:116211487-116211509 CAGGGACACCATGAGGACAGTGG - Intronic
1075702435 10:124478126-124478148 CAGAGGAGGCAGGAGGAGGGAGG + Intronic
1076438390 10:130462290-130462312 CACGGGACCCATGGGGAAGGGGG + Intergenic
1076813958 10:132905317-132905339 CAGGAGGACCCTGGGGAGGGCGG - Intronic
1077190625 11:1254660-1254682 CAGGGGAACCCTGAGCTGGGAGG - Intronic
1077333771 11:1994502-1994524 CCAGGGGACCAGGAGGAGGGAGG - Intergenic
1080099557 11:28443819-28443841 CAGGGGAACAATGATGAAGGTGG - Intergenic
1080319593 11:30991112-30991134 CCTGGTAACCATGAGGAGGCTGG + Intronic
1083609798 11:63999395-63999417 CAGGGGTAGCCTGAGGCGGGTGG + Exonic
1084662523 11:70554551-70554573 CAGAGGAACCTGGGGGAGGGGGG - Intronic
1086461818 11:87013508-87013530 CAGGGGAACTCAGAGGAGGGGGG + Intergenic
1089213599 11:116822318-116822340 CAGTGGAATCAAGGGGAGGGAGG - Intronic
1090076741 11:123584497-123584519 CAGGGCAGCCTTGGGGAGGGAGG + Intronic
1090419595 11:126565082-126565104 CAGGGGAGCACTGAGTAGGGAGG + Intronic
1090428428 11:126626561-126626583 CAGGAGAAACATGAGTAAGGGGG + Intronic
1091142232 11:133245042-133245064 CAGGGAAATCATGAGGAAGATGG - Intronic
1202816752 11_KI270721v1_random:49684-49706 CCAGGGGACCAGGAGGAGGGAGG - Intergenic
1091645951 12:2272390-2272412 CCGGGGAAGCAGGAGGAGGCAGG - Intronic
1092279549 12:7089205-7089227 CAGGGGATCCAGGAGGAAGTTGG + Intronic
1093706053 12:22276017-22276039 CAGGGGAATGATATGGAGGGAGG + Intronic
1096186866 12:49587259-49587281 CAGGGGAGCCAGGTGTAGGGAGG - Intronic
1096846191 12:54408336-54408358 AAAGGGAAGCATGGGGAGGGTGG + Intronic
1097683520 12:62671118-62671140 CAGGGGAACTTTGAGGATGTGGG - Intronic
1099943200 12:89214593-89214615 CGGGGCAACCATGAGTAAGGTGG + Intergenic
1100863566 12:98832330-98832352 CAGGGGCACAAAGAGAAGGGAGG + Intronic
1102269126 12:111516193-111516215 CTGGAGAACCATGAGCAGAGGGG + Exonic
1102471716 12:113163202-113163224 CAGGGGAGCCAAGAGGCGGAGGG - Exonic
1102679816 12:114683867-114683889 CAGAGGAAGGAGGAGGAGGGCGG - Intronic
1104122738 12:125814616-125814638 GAGGGGGACCATGAATAGGGTGG + Intergenic
1104707436 12:130958061-130958083 GAGGGGAACAGTGAGGAGGAAGG - Intronic
1106171617 13:27293468-27293490 GCGGGGAAGAATGAGGAGGGAGG - Intergenic
1106388131 13:29307878-29307900 CATGGAAACTCTGAGGAGGGGGG - Intronic
1107787238 13:43969292-43969314 CAGGGGCTTCATGAGGGGGGAGG - Intergenic
1113424707 13:110198494-110198516 CAGGGGAACCAGGAGGACCCGGG + Exonic
1117652246 14:57919115-57919137 CAGAGGAACCATGAGATGGAAGG + Intronic
1117737777 14:58785007-58785029 TAGGGGAAGCATGAGGATGGTGG - Intergenic
1119222995 14:72924603-72924625 CAGGGGACACTTGAGGAAGGTGG - Intergenic
1119955764 14:78797134-78797156 CAGGGGAACCTTTCTGAGGGGGG + Intronic
1121445182 14:93974130-93974152 CAGGGGAACTCAGAGGAGAGAGG - Intronic
1121764091 14:96470539-96470561 CTTGGGAAGGATGAGGAGGGAGG - Intronic
1122118750 14:99540773-99540795 CAAGGGATCCATGAAGAGGGCGG - Intronic
1122143520 14:99675920-99675942 CTGTGGGACCCTGAGGAGGGAGG + Exonic
1122529813 14:102417860-102417882 CAGGGGAGCCGTGGGGAGGCTGG + Intronic
1124374681 15:29122597-29122619 AAGGGGGCCCAAGAGGAGGGGGG + Exonic
1124510025 15:30316011-30316033 CAGGGGCTTCATGAAGAGGGTGG - Intergenic
1124732865 15:32214542-32214564 CAGGGGCTTCATGAAGAGGGTGG + Intergenic
1125306205 15:38318577-38318599 CAGGGGAAAGAGAAGGAGGGAGG - Intronic
1125423257 15:39525673-39525695 CAGGGCAAATATGAGGAAGGAGG + Intergenic
1125483882 15:40099022-40099044 CAGGGGAAGAATGAGGCTGGGGG - Intronic
1126662847 15:51049141-51049163 CATGGGAACCATGAGAAAAGTGG - Intergenic
1127635404 15:60864768-60864790 CAGGAGCCCCATGAAGAGGGTGG + Intronic
1127953641 15:63834062-63834084 AAGGGGAACCGAGAGGAAGGCGG + Intergenic
1128156286 15:65393945-65393967 CAGGGGAAGGGTGAGGAAGGAGG - Intronic
1130894573 15:88160170-88160192 CTGGGGAACCCAGAGGAAGGAGG + Intronic
1131111925 15:89769956-89769978 CAGGGGAACCAAATGAAGGGTGG + Intronic
1131825996 15:96322862-96322884 CAGGGCAACCCTTAGTAGGGCGG - Intergenic
1132544851 16:528261-528283 CAGAGGAACCCAGAGGAAGGCGG + Intronic
1132656608 16:1044241-1044263 CAGGGGTCCCAGGAGGAGGGCGG - Intergenic
1132710312 16:1263417-1263439 CAGGGTGACCATGAGGATAGGGG + Intergenic
1134085570 16:11355213-11355235 CAGGTGAAGCAGGAGGAGGAAGG + Intergenic
1134384214 16:13756906-13756928 AAGGGTAAACTTGAGGAGGGAGG - Intergenic
1134904912 16:17972040-17972062 GTGGGGCACCAAGAGGAGGGTGG - Intergenic
1135398252 16:22147476-22147498 CTGGGGCATCAGGAGGAGGGAGG + Intronic
1135492859 16:22924955-22924977 CAGAATAACCATGAGAAGGGAGG + Intergenic
1135615284 16:23906074-23906096 CATTGGAATCATGAGGACGGAGG + Intronic
1139820473 16:69717127-69717149 CCTGGAAACCACGAGGAGGGTGG - Intronic
1140593720 16:76383430-76383452 GAGGGGAACAATGAGCAAGGTGG + Intronic
1141032198 16:80598787-80598809 CAGGGGGAGCATGAGGTTGGTGG + Exonic
1141441324 16:84031511-84031533 CAGGGGAACAGTGAGGAGGCCGG - Intronic
1142256281 16:89015276-89015298 CAGGGGCTGGATGAGGAGGGGGG + Intergenic
1142981744 17:3676404-3676426 CTGGGGAACCGGGAGGACGGAGG + Intronic
1143022057 17:3921906-3921928 CGGGTGGACCATGTGGAGGGAGG + Intergenic
1143951844 17:10638748-10638770 AAAGGGAACCATGAGGCAGGTGG + Intronic
1144763048 17:17718127-17718149 CAGGGGAAGCAGGGGGAGAGGGG - Intronic
1145059965 17:19726688-19726710 GAGGAGAACGAGGAGGAGGGGGG + Intergenic
1146265576 17:31450605-31450627 AAAGGGACCCAGGAGGAGGGCGG - Intronic
1146583318 17:34059381-34059403 ACAGGGAACCATCAGGAGGGTGG + Intronic
1147034553 17:37670579-37670601 CGGGAGAAGCAGGAGGAGGGAGG + Intergenic
1147361620 17:39934203-39934225 CTGGGGAACCAAGTGCAGGGAGG + Intergenic
1147563872 17:41524838-41524860 AAGAAGAACCATGAGGAGGTGGG - Exonic
1147742410 17:42676649-42676671 CAGGGGAAAGATGAGGTGGGAGG + Exonic
1147873113 17:43601788-43601810 CAGGGTAATCGTGAGGAGGCAGG - Intergenic
1148469712 17:47885418-47885440 CAGGGGAACAGTGTGGAGAGAGG + Intergenic
1149540296 17:57463441-57463463 CAGTGGGGCCATGGGGAGGGAGG - Intronic
1151127900 17:71865091-71865113 CAGGGCAACAAAGAGGAAGGGGG + Intergenic
1152504764 17:80741528-80741550 CAGGAGGACCATGAGGCTGGAGG + Intronic
1152630320 17:81408080-81408102 CAGGGGCAGCAGGAGGAAGGGGG - Intronic
1152933491 17:83122515-83122537 CAGGGGAACCAGGTGGAGGGCGG + Intergenic
1158503186 18:58022041-58022063 TCGGGGAGCCATGGGGAGGGAGG + Intergenic
1159720295 18:71881543-71881565 CTGGGGGAGGATGAGGAGGGAGG - Intergenic
1160312050 18:77803243-77803265 CAGGGGAAAGATGAGGAACGTGG - Intergenic
1160623526 18:80187609-80187631 CAGGGGAGCCAGGAGGTGGATGG - Intronic
1160732856 19:649141-649163 CAGGGGACCCAGGAGCGGGGGGG - Intronic
1161085440 19:2332963-2332985 GAGGGGGAGCAGGAGGAGGGTGG + Intronic
1161085461 19:2333024-2333046 GAGGGGGAGCAGGAGGAGGGTGG + Intronic
1161085499 19:2333145-2333167 GAGGGGGAGCAGGAGGAGGGTGG + Intronic
1161143493 19:2663348-2663370 CTGGGGAAGAAAGAGGAGGGGGG - Intronic
1161559209 19:4962231-4962253 CAGGAGAAACATGAGGCAGGTGG + Intergenic
1161578342 19:5067092-5067114 CAGGGGAGCCTTCGGGAGGGAGG - Intronic
1161993218 19:7697149-7697171 CTGGGGAACCACGAGGCTGGGGG - Intronic
1162406802 19:10479652-10479674 CTGGGGAGCCTTGAGGAAGGGGG - Intergenic
1162926044 19:13930938-13930960 CAGGGGAACCGGGGGGTGGGTGG - Intergenic
1163222043 19:15928808-15928830 CAGGAGAGCCATGAATAGGGTGG + Intronic
1163546132 19:17942456-17942478 CAGGGGAACCTTGGACAGGGCGG - Intronic
1163737498 19:18990372-18990394 CAGAGGAACCATGGGCAGGCTGG + Intergenic
1164330312 19:24248029-24248051 TATGGGAACCATCAGGATGGAGG - Intergenic
1164743578 19:30594731-30594753 CAGGGGAAACAGGAGAAGAGTGG - Intronic
1164803594 19:31098698-31098720 CATGGGAACCAGGAGGAAGCAGG - Intergenic
1166541831 19:43610843-43610865 CTGGGGACCCAGCAGGAGGGTGG - Intronic
1167226878 19:48250454-48250476 CAGGAAAGCCATGAAGAGGGGGG - Intronic
1168467449 19:56614893-56614915 CAGGGGATCCCTGGGGATGGGGG - Intronic
925158188 2:1662891-1662913 CATGGGGACCATGGGGAGTGGGG - Intronic
925237724 2:2293764-2293786 CAGAGGAGCCGGGAGGAGGGAGG - Intronic
925386084 2:3462804-3462826 CAGGGGCACCCGGGGGAGGGGGG - Intronic
925507467 2:4584245-4584267 TAGGGGAACAATGGGGAGGTGGG - Intergenic
925914153 2:8592878-8592900 CAGGGAGGCCATGAGGAGTGCGG - Intergenic
926195512 2:10761417-10761439 GAGGGTAACCAGGAGGATGGCGG - Intronic
927810982 2:26180036-26180058 CAGAGGAAAAATGTGGAGGGGGG - Intronic
930482030 2:51960565-51960587 CTGTGGAAACATGATGAGGGTGG + Intergenic
930858669 2:56045930-56045952 CAGGGGAACCAGGTGAAGTGTGG + Intergenic
932105161 2:68935555-68935577 CAGGAGATCCATGCGGAGTGAGG + Intergenic
932727019 2:74188332-74188354 CAGTGGAAGTGTGAGGAGGGTGG - Intergenic
932770680 2:74499264-74499286 ACGGGGAACCAGGAGGAGAGAGG + Intronic
936291306 2:111225975-111225997 AAGGGGAACCAGTGGGAGGGAGG + Intergenic
936950684 2:117974653-117974675 CATGGGAACCTCTAGGAGGGAGG - Intronic
938070494 2:128305789-128305811 CAGCTGGACCTTGAGGAGGGTGG + Intronic
938105353 2:128526312-128526334 CAGGAGAACCAGAGGGAGGGTGG - Intergenic
938291017 2:130150578-130150600 CTGGGGCACAAGGAGGAGGGAGG - Intergenic
938465527 2:131522378-131522400 CTGGGGCACAAGGAGGAGGGAGG + Intergenic
939460177 2:142488754-142488776 CAGGGAACTCATGAAGAGGGTGG - Intergenic
939879652 2:147615527-147615549 CAGGAGAACTTTGAGAAGGGAGG + Intergenic
940703693 2:157077501-157077523 GAGGGGAACTCTGAGGTGGGAGG + Intergenic
940809802 2:158229732-158229754 GAGGGGACAGATGAGGAGGGAGG - Intronic
941293919 2:163712019-163712041 TGGAGGAACCATGTGGAGGGTGG - Intronic
942470082 2:176251000-176251022 CAGGGGAACCCTGCAGAGGGCGG - Intergenic
943580803 2:189681721-189681743 CAGGTGATCCCTGGGGAGGGAGG + Intronic
944215238 2:197247989-197248011 AAGGGGAATGATGAGGAGGGAGG - Intronic
944523111 2:200591311-200591333 CATGGGAACAAAGAGGAGGATGG + Intronic
944657603 2:201891566-201891588 CAGGGTAATCTTGAGGAGGAAGG + Intronic
946272541 2:218606253-218606275 AAGGGGACACATTAGGAGGGAGG - Intergenic
946386260 2:219386215-219386237 CACGGGTACCCTGAGGAGTGTGG + Intronic
946496696 2:220202633-220202655 CAGATGAACCATGAGGAGCATGG - Intergenic
946777150 2:223155291-223155313 CAGGGAAACCATAGAGAGGGGGG - Intronic
947855259 2:233319637-233319659 CAGGGCACCCAGGAGGAAGGTGG - Intronic
948753978 2:240148688-240148710 TAGAGGGACCATGAGGAGTGAGG + Intergenic
1168900312 20:1358306-1358328 CATGGGAAGAAGGAGGAGGGAGG + Intronic
1169449128 20:5696400-5696422 CAAGGGAAACATGAGGACAGTGG + Intergenic
1170467131 20:16632421-16632443 CAAGGGAACCATGAAGGGTGTGG - Intergenic
1170480659 20:16761866-16761888 CAGGGGCACCATGGGGTGGCTGG + Intronic
1170928295 20:20745496-20745518 CAGAGGACCCATGAGGAGCCTGG + Intergenic
1172602382 20:36192800-36192822 TAGAGTAGCCATGAGGAGGGAGG + Intronic
1172699269 20:36843018-36843040 CAGTGGCAGCATGAGGAGGGAGG - Intronic
1172782913 20:37447783-37447805 CAGAGGAAACAGGAGAAGGGTGG - Intergenic
1173403649 20:42746381-42746403 CCGGGCACCCATGAGGAGGATGG + Intronic
1174104919 20:48155287-48155309 CAGGGAAAACAAGAAGAGGGGGG - Intergenic
1174841103 20:53902136-53902158 CAGGGGAAGCTTGAGCTGGGAGG + Intergenic
1174850585 20:53990208-53990230 CTGGGGAAACCTGAGGAGAGAGG + Intronic
1175728226 20:61333905-61333927 CAGGGGCACCATGAGGTGACTGG + Intronic
1176143291 20:63554312-63554334 CAGGGGAGCCAAGGGGAGTGTGG + Exonic
1176169834 20:63691788-63691810 CAGAAGAACCGCGAGGAGGGAGG + Exonic
1177355440 21:19999874-19999896 AAGGGGCTGCATGAGGAGGGTGG + Intergenic
1178286688 21:31331413-31331435 CAGGGGAAAAATGAGGAAGGAGG + Intronic
1180205471 21:46256749-46256771 CAGGGGAGCCCTGACGAGGCAGG + Intronic
1181031468 22:20150406-20150428 CAGGGGTACCAGGCGGTGGGTGG + Intronic
1181236031 22:21448172-21448194 CAGGGGAACCATGAGGAGGGTGG + Exonic
1181443212 22:22949284-22949306 CAGGGCAACCAGGGGCAGGGTGG + Intergenic
1181596112 22:23915870-23915892 CAGGGGAACCATGTGAGGGGAGG + Intergenic
1182416044 22:30222117-30222139 CAGGAGAACCATGGGGATGTTGG + Intergenic
1183284490 22:36953534-36953556 CAAGGGGAGCAGGAGGAGGGTGG + Intergenic
1184209768 22:43028574-43028596 CCGGGGAACCATGGGAGGGGAGG + Intergenic
1184413526 22:44339139-44339161 CAGGGAAACACTGGGGAGGGGGG - Intergenic
1184537119 22:45094712-45094734 GATTGGAGCCATGAGGAGGGGGG - Intergenic
1185075037 22:48678427-48678449 CAGAGGAACCAGGAAGAGGTCGG + Intronic
1185234770 22:49705352-49705374 CAGGAGAACCACGAGGAGGACGG + Intergenic
950387419 3:12671079-12671101 GAGGGGCACCAAGAGGAGGGAGG + Intergenic
953414413 3:42707442-42707464 CAGGGGCTCCCTGAGGAGTGGGG + Intronic
953927394 3:46989400-46989422 GAAGGGAACCCAGAGGAGGGTGG + Intronic
955391382 3:58524746-58524768 AGGGGGAACCCTCAGGAGGGAGG - Intronic
956302228 3:67784631-67784653 CAGGGGAAGAATTAGGAGGATGG + Intergenic
960532877 3:118785171-118785193 CTGGGGAGCCATGAGAAAGGAGG - Intergenic
961872059 3:129995853-129995875 CAGGGAAGCCATGGGAAGGGTGG + Intergenic
964201266 3:154121554-154121576 GAGGGTACCCATGATGAGGGCGG + Intronic
965827568 3:172746120-172746142 CAGGGAGACCAAGAGGAGGAAGG + Intergenic
966248404 3:177834477-177834499 AAGGAGAACAAAGAGGAGGGTGG + Intergenic
966439273 3:179925993-179926015 CAGGAGAAACATTTGGAGGGGGG - Intronic
966905994 3:184526051-184526073 CAGGTGGAGCAAGAGGAGGGCGG + Intronic
968009222 3:195262323-195262345 CAGGGGAGACAGGAGGACGGAGG + Intronic
968534155 4:1113146-1113168 CAGGGGAACTCTGAGGGGAGGGG - Intronic
968621347 4:1604729-1604751 CTGGGGAAGCAGGAGGAGGCGGG - Intergenic
969340001 4:6534745-6534767 CAGGGCAGCCATGCGGAGGCGGG - Intronic
970195577 4:13547597-13547619 GAGGAGAAGCAGGAGGAGGGAGG - Intergenic
971375246 4:26050907-26050929 CAGTGGAAGCATGAGGAAGCTGG - Intergenic
973699633 4:53523851-53523873 CAGGGGAAGCAGGAGGATGGTGG - Intronic
973936552 4:55852454-55852476 CAGGGAATCCAAGAGGAGAGAGG + Intergenic
975720772 4:77246744-77246766 CAGGGGAACACTGACTAGGGAGG - Intronic
976549912 4:86381969-86381991 TAGAGAAACCCTGAGGAGGGAGG - Intronic
978404477 4:108364724-108364746 ATGGGGAAGCAGGAGGAGGGTGG - Intergenic
978610560 4:110534156-110534178 CAAAGAAACCAAGAGGAGGGAGG - Intronic
978618995 4:110621330-110621352 CAGGGGAAGAATGAGGACGTGGG - Exonic
981667266 4:147243876-147243898 CAGGCAGACCAAGAGGAGGGAGG - Intergenic
983100095 4:163614927-163614949 AAGGGAAACCCTGAGGAAGGTGG + Intronic
984220401 4:176967568-176967590 CAGGGGAAGCATGAGGGGGTGGG + Intergenic
984463066 4:180059456-180059478 GATGGGAACCGAGAGGAGGGTGG + Intergenic
985063062 4:186097107-186097129 CAGGGGCTCCCTAAGGAGGGAGG - Intergenic
985278012 4:188257700-188257722 CAGTGAAAGCATGAGGATGGGGG - Intergenic
986082078 5:4405473-4405495 CAGGGGAAGCTTGAGTAGGGAGG + Intergenic
987099397 5:14578897-14578919 CAGGAGAACCCTGAAGAAGGGGG + Intergenic
987207392 5:15641443-15641465 CAGGGAAACCAAGAGGAATGGGG + Intronic
987315059 5:16716377-16716399 CAGGGACACCAAGAGCAGGGAGG + Intronic
989158974 5:38371939-38371961 CAGGAGTTCCATGGGGAGGGTGG - Intronic
989534714 5:42550374-42550396 CAGGGGAACCTTGGGGAGGCAGG - Intronic
991605440 5:68396138-68396160 CAGTGGAAGAATGAGGAAGGGGG + Intergenic
992073896 5:73173663-73173685 CTGGAGAACCATAAGGAGGAGGG - Exonic
995631383 5:114136547-114136569 CAGTGGAACCTGGTGGAGGGAGG + Intergenic
998006870 5:138662938-138662960 CATGGGAAGGATGAGGAGGTAGG - Intronic
998199428 5:140107864-140107886 CAGGGGAAGGAGGAGGAGGAGGG + Intronic
999141323 5:149364243-149364265 CAGGGGAACCGAGAAGAGGTGGG + Intronic
999380357 5:151117161-151117183 CAGGGGCATCGTGAGGAGGGAGG - Exonic
999687664 5:154117195-154117217 CAGGGGACCCATGCTGAGGAGGG + Intronic
1000335031 5:160235710-160235732 CAGGGAAGACATGATGAGGGAGG + Intronic
1002065909 5:176651545-176651567 CCGGGGAAGGATGAGGGGGGAGG + Intronic
1002133344 5:177094479-177094501 GGGGGGAACCATAAGGAAGGAGG - Intronic
1002715751 5:181225868-181225890 CAGTGGGACCAGGAGGAGGAGGG + Intronic
1004866294 6:19856566-19856588 CAGTGGTGCCAGGAGGAGGGGGG + Intergenic
1005231312 6:23704645-23704667 CAGGGGAAGGAGTAGGAGGGAGG + Intergenic
1006079938 6:31559253-31559275 CTGGGGGGCCATGAGGAGGCTGG + Intergenic
1006151232 6:31991318-31991340 GAGGGGAAGGATGAGTAGGGAGG + Intronic
1006157533 6:32024056-32024078 GAGGGGAAGGATGAGTAGGGAGG + Intronic
1006334630 6:33414176-33414198 CAGGGGAGTCCTGAGGTGGGAGG - Intronic
1006338154 6:33431686-33431708 CAGGGGTTCCAGGAGGTGGGGGG + Intronic
1006425110 6:33958853-33958875 CAGGGGACCAATGAGCAAGGAGG - Intergenic
1007747107 6:44049975-44049997 CAGGAGAGCCCTGAGCAGGGTGG + Intergenic
1007765117 6:44155334-44155356 TAGGGGATGCATGAGGGGGGAGG + Exonic
1011856517 6:91699642-91699664 CTAGGGAAGCCTGAGGAGGGTGG + Intergenic
1013005963 6:106073734-106073756 CCAGTGACCCATGAGGAGGGAGG + Intergenic
1013279572 6:108622977-108622999 CAGTGGAAGCAACAGGAGGGTGG + Intronic
1013370855 6:109470020-109470042 CCTGGGAATGATGAGGAGGGTGG + Intronic
1013722578 6:113048654-113048676 CAAGTGAATCATGAGGAGGAGGG - Intergenic
1015669686 6:135674248-135674270 TTTGGGAACCATGCGGAGGGTGG - Intergenic
1017068594 6:150552075-150552097 CAGGGGGACTGTGGGGAGGGTGG + Intergenic
1018197663 6:161368961-161368983 CAGCGGATCCACGGGGAGGGAGG + Intronic
1018297503 6:162364746-162364768 AAGGGGAATCAGGAAGAGGGAGG + Intronic
1019014169 6:168867649-168867671 CAGGGGTAGCATGGGGACGGAGG + Intergenic
1019346170 7:531764-531786 CAGGGGAGCCACGAGGCGGAGGG + Intergenic
1019531728 7:1506644-1506666 AAGGGGAACGAAGGGGAGGGGGG - Intergenic
1019660186 7:2219775-2219797 CTGGAGCACCAGGAGGAGGGTGG - Intronic
1020853563 7:13388993-13389015 CAGGGGCACCATGATCAGGGTGG - Intergenic
1023569121 7:41554176-41554198 CAGGGGAACCCTTAGCAGGTAGG + Intergenic
1023735670 7:43234242-43234264 CACTGGAAGGATGAGGAGGGAGG - Intronic
1024100798 7:46030733-46030755 CTGAGGAACCCTGGGGAGGGTGG + Intergenic
1024999561 7:55303694-55303716 GAGGGGAAGGAAGAGGAGGGAGG + Intergenic
1025068087 7:55874869-55874891 CATGGGCACCATGGGGGGGGGGG - Intergenic
1025625096 7:63214077-63214099 CAGAGGAACCTTCTGGAGGGTGG + Intergenic
1025818604 7:64942979-64943001 CAGGGGAATGAGGAGGAGCGGGG + Intergenic
1027368872 7:77486889-77486911 TAGGGGAACTATGAGGAATGTGG + Intergenic
1029397463 7:100318137-100318159 CACGGGAACCCAGAGGAGGTTGG - Intronic
1029467702 7:100736647-100736669 CCAGGGGACCATGAGCAGGGAGG + Intronic
1029645858 7:101855335-101855357 CAGGGGGACCATGAGGTGAGGGG + Intronic
1029732380 7:102446886-102446908 CACGGGCACCATGATGATGGTGG - Exonic
1029750378 7:102539626-102539648 CAGGAGGACCGTGAGGAGGACGG + Intronic
1029768330 7:102638734-102638756 CAGGAGGACCGTGAGGAGGACGG + Exonic
1031024352 7:116663878-116663900 CAAGGTCACCATCAGGAGGGAGG + Intergenic
1032433127 7:131879214-131879236 CAGGGCAGCCATGAGGAGTAAGG + Intergenic
1032794660 7:135268190-135268212 CAGTGGACCCAGGAGGAAGGAGG - Intergenic
1033289306 7:140069567-140069589 CAGGAGAACCCTGATGAAGGAGG - Intergenic
1033454645 7:141491862-141491884 CAGGGGAGAGATGAGGAGGCAGG - Intergenic
1034200766 7:149281804-149281826 CAGCGGACCCATGTGGAGGAGGG + Exonic
1034267095 7:149786319-149786341 GAGGGAGACCAGGAGGAGGGAGG - Intergenic
1034356150 7:150451882-150451904 CAGGGCAACCATCAAGAGGAAGG - Intronic
1034533402 7:151711964-151711986 CTGGGAAACCCAGAGGAGGGCGG - Intronic
1034556161 7:151851749-151851771 AGGGGGACCCATGAGGAGGGAGG - Intronic
1034958799 7:155351585-155351607 CTGGGGAGGCATGAGGAAGGCGG + Intergenic
1035290839 7:157837495-157837517 AAGGGGCACCATGAGGAGCCAGG + Intronic
1035589503 8:802149-802171 CAGAGGACCCAGGAGGAGTGCGG - Intergenic
1039971761 8:42326460-42326482 CAGTGGCACCGGGAGGAGGGTGG - Intronic
1041884736 8:62795361-62795383 CAGGGGACCCATGAACATGGTGG - Intronic
1042699547 8:71597195-71597217 CACTGAAACCATGAGGATGGGGG + Intergenic
1042714403 8:71756724-71756746 CAGGGGAACAGTGAGGAATGAGG - Intergenic
1043553172 8:81398390-81398412 CAGGGGATTCATGGGGTGGGGGG + Intergenic
1049300800 8:141868430-141868452 CAGGGGAACCTTGAGAGGTGGGG - Intergenic
1049558182 8:143294084-143294106 GAGGGGCAGCAGGAGGAGGGGGG - Intronic
1049565322 8:143335039-143335061 CAGGGAAACCAGGGGGAGGCCGG - Intronic
1052123391 9:24745966-24745988 CAGGCGTACGATGAGAAGGGAGG - Intergenic
1053004343 9:34594122-34594144 CAGGGGCACCATTAGGAGGGGGG + Intergenic
1053131614 9:35618679-35618701 CAAGGCAGCCAGGAGGAGGGTGG - Intronic
1056499864 9:87198102-87198124 CAGGAGAACCTTCAGGAGTGAGG - Intergenic
1056753605 9:89368587-89368609 CAGGGGCCCCAAGAGGAGGGAGG + Intronic
1056755155 9:89377013-89377035 AAGAGGAGCCAGGAGGAGGGAGG + Exonic
1058375327 9:104316152-104316174 CAGGAGAACCATGGGGAGCCCGG - Intergenic
1059510430 9:114839925-114839947 CAGGGGAGCCATGAGCAGCAGGG - Intergenic
1060816501 9:126638090-126638112 CTGGGGAAGCATGGGGAGAGGGG + Intronic
1061192048 9:129087791-129087813 CCGGGGATCCATGAGGAAAGGGG + Intronic
1061194075 9:129098091-129098113 CAGGTGAAACATGCGCAGGGAGG + Exonic
1061878057 9:133554690-133554712 CGAGGTAACCAGGAGGAGGGAGG + Exonic
1062055392 9:134467267-134467289 GAGGGGACCCGTGAGAAGGGAGG + Intergenic
1062633331 9:137477198-137477220 CCTGGGAGCCACGAGGAGGGTGG - Intronic
1185571852 X:1140752-1140774 CAAAGGAACCCTCAGGAGGGTGG - Intergenic
1186313163 X:8342079-8342101 GAGGAGAAGCAGGAGGAGGGAGG - Intergenic
1187073676 X:15913372-15913394 CAGGGCAAGCATGTGGATGGAGG - Intergenic
1187163971 X:16787359-16787381 GAGGGGAAAAAAGAGGAGGGTGG - Intronic
1189229797 X:39443357-39443379 CAGGGGGACAATGGGGAGGGTGG + Intergenic
1189834292 X:45005026-45005048 AAGAGGTACCATAAGGAGGGGGG - Intronic
1190122285 X:47672172-47672194 AAGGGGAAGCATGAGTAGGAAGG - Intergenic
1190289229 X:48981325-48981347 CAGGGGTAACATGAGGACTGAGG + Intronic
1191255203 X:58276689-58276711 CAGGGGAAGGTTGAGGAGGCCGG - Intergenic
1191764488 X:64682365-64682387 CAGGGGACACAGGAGGAAGGGGG + Intergenic
1192216750 X:69164661-69164683 CACTGGAACCTTGAGGATGGAGG + Intronic
1192219324 X:69186452-69186474 CAACGGAATCATGAGGTGGGTGG - Intergenic
1192738901 X:73874670-73874692 CAGGGAAGAAATGAGGAGGGAGG + Intergenic
1195954070 X:110310286-110310308 CTGGGGAACCATGAGGATGGTGG - Intronic
1200149588 X:153944700-153944722 CAGCGGAACCCTGAAGAGGAGGG - Intergenic