ID: 1181236082

View in Genome Browser
Species Human (GRCh38)
Location 22:21448379-21448401
Sequence CTGGCTAATTACCAAGATGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 523
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 497}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181236082_1181236086 -4 Left 1181236082 22:21448379-21448401 CCCTCATCTTGGTAATTAGCCAG 0: 1
1: 0
2: 0
3: 25
4: 497
Right 1181236086 22:21448398-21448420 CCAGCCTCAGATACTTCTGTGGG 0: 1
1: 0
2: 2
3: 15
4: 196
1181236082_1181236089 8 Left 1181236082 22:21448379-21448401 CCCTCATCTTGGTAATTAGCCAG 0: 1
1: 0
2: 0
3: 25
4: 497
Right 1181236089 22:21448410-21448432 ACTTCTGTGGGCCCTGAAGTGGG 0: 1
1: 0
2: 1
3: 27
4: 224
1181236082_1181236084 -5 Left 1181236082 22:21448379-21448401 CCCTCATCTTGGTAATTAGCCAG 0: 1
1: 0
2: 0
3: 25
4: 497
Right 1181236084 22:21448397-21448419 GCCAGCCTCAGATACTTCTGTGG 0: 1
1: 1
2: 1
3: 18
4: 184
1181236082_1181236088 7 Left 1181236082 22:21448379-21448401 CCCTCATCTTGGTAATTAGCCAG 0: 1
1: 0
2: 0
3: 25
4: 497
Right 1181236088 22:21448409-21448431 TACTTCTGTGGGCCCTGAAGTGG 0: 1
1: 0
2: 4
3: 11
4: 146
1181236082_1181236093 28 Left 1181236082 22:21448379-21448401 CCCTCATCTTGGTAATTAGCCAG 0: 1
1: 0
2: 0
3: 25
4: 497
Right 1181236093 22:21448430-21448452 GGGCTCTCAAGGTCAGACCAAGG 0: 1
1: 0
2: 2
3: 11
4: 123
1181236082_1181236090 17 Left 1181236082 22:21448379-21448401 CCCTCATCTTGGTAATTAGCCAG 0: 1
1: 0
2: 0
3: 25
4: 497
Right 1181236090 22:21448419-21448441 GGCCCTGAAGTGGGCTCTCAAGG 0: 1
1: 0
2: 0
3: 27
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181236082 Original CRISPR CTGGCTAATTACCAAGATGA GGG (reversed) Exonic
901464475 1:9412548-9412570 CTGGCTGCTTGCCAAGGTGAAGG - Intergenic
902105372 1:14031374-14031396 TTGGCTAGCTACCCAGATGAAGG + Intergenic
902111882 1:14086291-14086313 CAGGCTTAATACCTAGATGATGG - Intergenic
904224496 1:29004573-29004595 CTGGCAAATTAGAAAGACGAAGG + Intronic
906839289 1:49119438-49119460 CTGGGTAAATAACAAAATGAAGG - Intronic
908733019 1:67246552-67246574 CTGGGTAAATAACAAAATGAAGG - Intronic
908821401 1:68090816-68090838 CTGGGTAAATAACGAGATGAAGG - Intergenic
909314772 1:74201846-74201868 CTGGCTTAATACCTAGGTGATGG - Intronic
909336544 1:74481139-74481161 CTGGCTATATATCAAAATGATGG + Intronic
909807644 1:79891801-79891823 CTGGGTAAATAACAAAATGAAGG - Intergenic
910635431 1:89402704-89402726 CTGGTTAAATAACAAAATGAAGG - Intergenic
910940902 1:92532686-92532708 CTGGGTAAATAACAAAATGAAGG + Intronic
910957126 1:92718443-92718465 CTGGGTAAATAACAAAATGAAGG + Intronic
911541087 1:99159477-99159499 CTGGGTAAATAACAAAATGAAGG - Intergenic
911595807 1:99797831-99797853 CTGGGTAAATAACAAAATGAAGG - Intergenic
911901485 1:103511636-103511658 CTGGGTAAATAACAAAATGAAGG + Intergenic
911963326 1:104335250-104335272 CTGGGTAAATAACAAAATGAAGG - Intergenic
911970882 1:104436074-104436096 CTGGCTAATTTTCAAGACAAAGG + Intergenic
911990918 1:104695770-104695792 CTGGGTAAATAACGAGATGAAGG + Intergenic
912000975 1:104834340-104834362 CTGGGTAAATAACAAAATGAAGG + Intergenic
912615183 1:111092717-111092739 CTGGGTAAATAACAAAATGAAGG + Intergenic
912636450 1:111298495-111298517 CTGGGTAAATAACGAGATGAAGG + Intronic
912886117 1:113476462-113476484 CTGGGTAAATAACAAAATGAAGG - Intronic
913720105 1:121584399-121584421 CTGGGTAAATAACAAAATGAAGG - Intergenic
914375186 1:147066807-147066829 CTGGGTACTTAACAAAATGAAGG + Intergenic
915711619 1:157904731-157904753 CTGGGTAAATAACAAAATGAAGG + Intergenic
917297968 1:173541760-173541782 CTGGTTAAATAACAAAATGAAGG + Intronic
917579332 1:176358767-176358789 CTGGGTAAATAACAAAATGAAGG + Intergenic
917773133 1:178302516-178302538 AGGGCTAAATACCATGATGATGG + Intronic
918353488 1:183682407-183682429 CTGGGTAAATAACAAAATGAAGG - Intronic
918838597 1:189504001-189504023 CTTTCTAATTACCCAGATTATGG + Intergenic
919199495 1:194336540-194336562 CTTGCTTATTACCAAGGGGATGG + Intergenic
921865132 1:220080819-220080841 CTGGCTACTGACGAAGATGGAGG - Intronic
923194206 1:231649297-231649319 CTGGGTAAATAACAAAATGAAGG - Intronic
923416483 1:233767391-233767413 CTGGGTAAATAACAAAATGAAGG - Intergenic
1063885379 10:10572447-10572469 CTGGTTTAATACCAAGGTGATGG - Intergenic
1064171570 10:13038259-13038281 CGGGCTTAATACCTAGATGATGG + Intronic
1064789215 10:18936766-18936788 CTGGGTAAATAACAAAATGAAGG - Intergenic
1065119094 10:22511469-22511491 CTGGGTAAATAACAAGATGAAGG - Intergenic
1065892139 10:30130538-30130560 CTTGACAATTACCAAGATGAGGG - Intergenic
1066012471 10:31207375-31207397 CTGGTTAATTACCAAGCCCAAGG - Intergenic
1066297823 10:34070381-34070403 CTGGGTAAATAACGAGATGAAGG + Intergenic
1066751518 10:38662082-38662104 CTGGGTAAATAACAAAATGAAGG + Intergenic
1066965519 10:42261013-42261035 CTGGGTAAATAACAAAATGAAGG - Intergenic
1067198986 10:44149645-44149667 CTGGGTAAATAACAAAATGAAGG - Intergenic
1067230868 10:44408944-44408966 CTGGGTAAATAACAAAATGAAGG - Intergenic
1068169326 10:53373002-53373024 CTGGGTAAATAACAAAATGAAGG + Intergenic
1068210262 10:53911360-53911382 CTGGGTAAATAACAAAATGAAGG + Intronic
1068228988 10:54145339-54145361 CTAGCTTATTTCTAAGATGAAGG + Intronic
1070003343 10:72398191-72398213 CTGGGTAAATAACAAAATGAAGG + Intronic
1070632766 10:78099261-78099283 CTGGGTAAATAACAAAATGAAGG + Intergenic
1070852118 10:79573235-79573257 CTGGGTAAATAACAAAATGAAGG + Intergenic
1071193710 10:83132699-83132721 CTGGGTAAATAACAAAATGAAGG - Intergenic
1071373221 10:84974842-84974864 CTGGGTAAATAACAAAATGAAGG + Intergenic
1071698219 10:87901064-87901086 CTGGGTAAATAACAAAATGAAGG - Intronic
1071748282 10:88446215-88446237 CTGGCTACATAACAAAATGAAGG + Intronic
1072017350 10:91361724-91361746 CTGGGTAAATAACAAAATGAAGG - Intergenic
1072375435 10:94811122-94811144 CTGGGTAAATAACAAAATGAAGG - Intronic
1072515965 10:96183554-96183576 CTGGGTAAATAACAAAATGAAGG - Intronic
1073746131 10:106470073-106470095 CTGGGTAAATAACAAAATGAAGG + Intergenic
1074017555 10:109549192-109549214 CTGGGTAAATAACAAAATGAAGG + Intergenic
1074673477 10:115822180-115822202 CTGGGTAAATAACAAAATGAAGG + Intronic
1075943987 10:126416659-126416681 CGGGCTTAATACCTAGATGATGG + Intergenic
1076925746 10:133484524-133484546 CTTGCTCATTACCATGAAGATGG + Intergenic
1078178233 11:8987040-8987062 CTGGCTAATTACCCTTATGATGG + Intronic
1078429500 11:11277741-11277763 CTGGGTAAATAACAAAATGAAGG - Intronic
1079550880 11:21695776-21695798 CTGGGTAAATAACAAAATGAAGG - Intergenic
1080288942 11:30649228-30649250 CTGGATAATTGCCACAATGAAGG - Intergenic
1080914419 11:36641514-36641536 CTGGCTACATAACAAAATGAAGG - Intronic
1081309001 11:41547666-41547688 CTGGGTAAATAACAAAATGAAGG + Intergenic
1082945370 11:58752741-58752763 CTGGGTAAATAACAAAATGAAGG + Intergenic
1083003405 11:59318705-59318727 CTGGGTAAATAACAAAATGAAGG - Intergenic
1083009649 11:59384892-59384914 CTGGGTAAATAACAAAATGAAGG - Intergenic
1085145587 11:74192667-74192689 CTCACTCATTACCAAGGTGATGG - Intronic
1086129496 11:83385866-83385888 CTGGGTAAATAACAAAATGAAGG + Intergenic
1086237441 11:84648621-84648643 CTCACTAATTACCAAAAGGAAGG - Intronic
1086312012 11:85546231-85546253 CTGGGTAAATAACAAAATGAAGG - Intronic
1086442325 11:86840861-86840883 CTGGGTAAATAGCAAAATGATGG + Intronic
1086530752 11:87782143-87782165 CTGGGTAAATAACAAAATGAAGG + Intergenic
1086645256 11:89211848-89211870 CTGGGTAAATAACAAAATGAAGG + Intronic
1087695030 11:101367038-101367060 CTGGGTAAATAACAAAATGAAGG - Intergenic
1087898536 11:103614235-103614257 CTGGGTAAATAACAAAATGAAGG + Intergenic
1087925440 11:103913402-103913424 CTGGGTAAATAACAAAATGAAGG + Intronic
1088656921 11:112008707-112008729 CTGGCTAAATAACGAAATGAAGG + Intronic
1088691091 11:112328847-112328869 CTGGATAAATAACAAAATGAAGG - Intergenic
1090199151 11:124841935-124841957 CTGGCTGCCTACCAAGACGAGGG + Intergenic
1090216041 11:124965881-124965903 CTGGGTAAATAACAAAATGAAGG - Intronic
1091980098 12:4857834-4857856 CTGGCTAATTACCACGATCGTGG + Intergenic
1092327314 12:7546526-7546548 CTGGGTAAATAACAAAATGAAGG + Intergenic
1093597440 12:20978979-20979001 CTGGGTAAATAACAAAATGAAGG - Intergenic
1093629102 12:21387282-21387304 AATGCTAATCACCAAGATGATGG + Intronic
1094791253 12:33918149-33918171 CTGGGTAAATAACAAAATGAAGG - Intergenic
1095128650 12:38511227-38511249 CTGGGTAAATAACAAAATGAAGG + Intergenic
1095489928 12:42723065-42723087 CTGGGTAAATAACAAAATGAAGG - Intergenic
1095793535 12:46193172-46193194 CTGGGTAAATAACAAAATGAAGG - Intronic
1095798736 12:46249236-46249258 CTGGGTAAATAACAAAATGAAGG + Intronic
1097912031 12:64981013-64981035 CTGGGTAAATAACAAAATGAAGG - Intergenic
1098451963 12:70629347-70629369 CTGGGTAAATAACAAAATGAAGG + Intronic
1098500070 12:71181817-71181839 TTGGCTAATTACCCAGTAGAGGG - Intronic
1098993635 12:77093690-77093712 CTGGGTAAATAACAAAATGAAGG - Intergenic
1099053189 12:77806406-77806428 CTGGGTAAATAACAAAATGAAGG - Intergenic
1099431180 12:82588049-82588071 CTGGGTAAATAACAAAATGAAGG + Intergenic
1099820211 12:87699511-87699533 CTGGGTAAATAACAAAATGAAGG - Intergenic
1099926457 12:89024527-89024549 TATGCTCATTACCAAGATGATGG - Intergenic
1100652104 12:96602196-96602218 CTGGGTAAATAACAAAATGAAGG - Intronic
1100901056 12:99240798-99240820 CTGGGTAAATAACAAAATGAAGG + Intronic
1101206326 12:102491732-102491754 CTGGGTAAATAACAAAATGAAGG - Intergenic
1101806464 12:108068533-108068555 CTGGCCACTAACCAAGAGGAAGG + Intergenic
1106360926 13:29029837-29029859 CTTGCTCATTACCAAAAGGAGGG + Intronic
1107439847 13:40416138-40416160 CTGGGTAAATAACAAAATGAAGG + Intergenic
1107536522 13:41340569-41340591 CTGGGTAAATAACAAAATGAAGG - Intronic
1107782960 13:43924735-43924757 CTCACTCATTACCAAGAGGATGG + Intergenic
1108673749 13:52718582-52718604 CTGGGTAAATAACAAAATGAAGG - Intronic
1108988001 13:56618671-56618693 CTGAATTATTACCAGGATGAGGG - Intergenic
1108989037 13:56631671-56631693 CTGGGTAAATAACAAAATGAAGG + Intergenic
1108998579 13:56766044-56766066 CTGGGTAAATAACAAAATGAAGG + Intergenic
1109047338 13:57429716-57429738 TGGGCTAAATACCTAGATGATGG + Intergenic
1109675670 13:65673031-65673053 CTGGGTAAATAACAAAATGAAGG - Intergenic
1110338831 13:74365034-74365056 CTGGCTCATCACCAAGTTCATGG - Intergenic
1110723876 13:78796795-78796817 CTGCCTCATTACCATGAGGATGG - Intergenic
1111341821 13:86896770-86896792 CTGGGTAAATAACAAAATGAAGG + Intergenic
1113342916 13:109444708-109444730 CTGGGTAAATAACAAAATGAAGG - Intergenic
1114608350 14:24016631-24016653 CTGGGTAAATAACAAAATGAAGG + Intergenic
1115053394 14:29092432-29092454 CTGGCAAAGTAACAAGATTAAGG - Intergenic
1115477334 14:33828370-33828392 CTGGCTACATAACAAAATGAAGG + Intergenic
1115815905 14:37164362-37164384 CTCCCTAATTACCCAGATAATGG + Intronic
1115869478 14:37783871-37783893 CTGGGTAAATAACAAAATGAAGG - Intronic
1116052595 14:39823261-39823283 CTGGGTAAATAACAAAATGAAGG - Intergenic
1116417433 14:44695813-44695835 CTGGGTAAATAACAGGATGAAGG + Intergenic
1117121364 14:52571237-52571259 CTGGGTAAATAACAAAATGAAGG + Intronic
1117729390 14:58706392-58706414 TGGGCTTAATACCAAGATGATGG - Intergenic
1117796772 14:59402958-59402980 CTGGGTAAATAACAAAATGAAGG - Intergenic
1117822615 14:59666341-59666363 CTGGGTAAATAACAAAATGAAGG + Intronic
1117892908 14:60445963-60445985 CTGGATAAATAACAAAATGAAGG + Intronic
1118361823 14:65063394-65063416 CTGGCTTTTTACCAAGAAGGAGG + Intronic
1119594644 14:75923450-75923472 CTGGGTAAATAACAAAATGAAGG - Intronic
1119930306 14:78539847-78539869 CTGGGTAAATAACAAAATGAAGG - Intronic
1121162004 14:91752161-91752183 CTCACTAATCACCAAGAGGATGG + Intronic
1123428959 15:20198069-20198091 CTGGGTAAATAACAAAATGAAGG - Intergenic
1124131791 15:26996419-26996441 CTGACTTATTACCAAAACGATGG - Intronic
1125837633 15:42767034-42767056 CTGGGTAAATAACAAAATGAAGG + Intronic
1126720349 15:51571686-51571708 CTGGGTAAATAACAAAATGAAGG + Intronic
1126848281 15:52782141-52782163 TGGGCTTAGTACCAAGATGATGG - Intronic
1126907475 15:53383598-53383620 CTCGCTCATCACCAAGAGGATGG + Intergenic
1127524764 15:59781906-59781928 CTGGGTAAATAACAACATGAAGG - Intergenic
1127570878 15:60240054-60240076 CTGGGTAAATAACAAAATGAAGG + Intergenic
1128603023 15:69013832-69013854 CTGGTTAATTTCCAAAATCAGGG - Intronic
1129224493 15:74160368-74160390 CTGGCTTAATACTGAGATGATGG - Intergenic
1131044819 15:89305649-89305671 CTGGCTAATCACCAAGCTTAAGG + Exonic
1134139541 16:11706125-11706147 CTGGCCAATTACCAGGCTAATGG - Intronic
1136731202 16:32415025-32415047 CTGGGTAAATAACAAAATGAAGG - Intergenic
1137347771 16:47681010-47681032 CTGGGTAAATAACAAAATGAAGG - Intronic
1137908580 16:52351938-52351960 CTGGCTAAGAACCACGATGTAGG + Intergenic
1137928220 16:52562119-52562141 CTGGATCATTACCATGAGGAAGG + Intergenic
1139248365 16:65470659-65470681 CTGGCTGAATACCTAGGTGATGG - Intergenic
1140885947 16:79242951-79242973 CTGGGTAAATAACAAAATGAAGG + Intergenic
1202995189 16_KI270728v1_random:102246-102268 CTGGGTAAATAACAAAATGAAGG + Intergenic
1203021876 16_KI270728v1_random:414588-414610 CTGGGTAAATAACAAAATGAAGG + Intergenic
1146885997 17:36471506-36471528 CAGCCTCATTAACAAGATGAAGG + Intergenic
1149240407 17:54642098-54642120 CTGGGTAAATAACAAAATGAAGG + Intergenic
1150147718 17:62783277-62783299 CTGGGTAAATAACAAAATGAAGG + Intronic
1150302628 17:64059212-64059234 CTGGCTACTTCCGTAGATGATGG + Intronic
1150610699 17:66730960-66730982 CTTGGTGGTTACCAAGATGATGG - Intronic
1153441530 18:5124888-5124910 CTGGGTAAATAACAAAATGAAGG + Intergenic
1154288313 18:13081845-13081867 CTGGGTAAATAACAAAATGAAGG - Intronic
1154382682 18:13866927-13866949 CTGGATAATTAGAAAGATGGTGG - Intergenic
1155414844 18:25586648-25586670 CTTGCTCATTACCAAGGGGAGGG + Intergenic
1155562602 18:27095154-27095176 ATGAGTAATTAGCAAGATGAGGG + Intronic
1155915894 18:31556921-31556943 CTGGCTCATCACCAAGGGGATGG - Intergenic
1156298259 18:35812307-35812329 CTGGGTAAATAACAAAATGAAGG + Intergenic
1156414797 18:36876916-36876938 CTGGGTAAATAACAAAATGAAGG - Intronic
1157091740 18:44644656-44644678 CTGGGTCATTACCATGAAGATGG + Intergenic
1157355108 18:46926325-46926347 CTGGGTAAATAACAAAATGAAGG - Intronic
1157561722 18:48651867-48651889 CTGGGTAAATAACAAAATGAAGG + Intronic
1158057126 18:53294628-53294650 CTGGCAGATTAACAAAATGAAGG + Intronic
1158413269 18:57226755-57226777 CTGGGTAAATAACAAAATGAAGG + Intergenic
1161019621 19:2002400-2002422 ATGGCTAATTATCAAGCTCAAGG + Intronic
1161535762 19:4817745-4817767 CTGGCTGATTTCCAAGTTGCTGG + Exonic
1163335912 19:16671507-16671529 CTGTCAAAAGACCAAGATGACGG - Intronic
1163798953 19:19353603-19353625 CTGGAAAATTCCCTAGATGATGG - Intronic
1164482653 19:28625609-28625631 CTGGCTAAATAACTAAATGAAGG - Intergenic
925122640 2:1431187-1431209 CTGACTCATCACCAAGAGGATGG - Intronic
926366329 2:12136696-12136718 CTGGGTAAATAACAAAATGAAGG - Intergenic
928754451 2:34507500-34507522 CTGGGTAAATAACAAAATGAAGG + Intergenic
928883247 2:36121178-36121200 CTGGGTAAATAACAAAATGAAGG - Intergenic
929163322 2:38855394-38855416 CTGACTTATTACCAAGAGGTGGG + Intronic
930264449 2:49183744-49183766 CTGGGTAAATAACAAGATGAAGG - Intergenic
930893960 2:56423932-56423954 CTGGGTACATACCAAAATGAAGG + Intergenic
930908650 2:56604068-56604090 CTGGGTAAATAACAAAATGAAGG - Intergenic
930952034 2:57155255-57155277 CTCACTTATTACCAAGGTGATGG + Intergenic
931594784 2:63929416-63929438 CTGGGTAAATAACAAAATGAAGG + Intronic
931985910 2:67742198-67742220 CTGGGTAAATAACAAAATGAAGG - Intergenic
932051294 2:68400971-68400993 CTGGGTAAATAACAAAATGAAGG - Intergenic
932052095 2:68408106-68408128 CTGGGTAAATAACAAAATGAAGG + Intergenic
932098622 2:68875406-68875428 CTGGCTAATAACCACCATGTTGG + Intergenic
932914155 2:75836877-75836899 CTGGGTAAATAACAAAATGAAGG + Intergenic
933607534 2:84399476-84399498 CTGGGTAAATAACAAAATGAAGG + Intergenic
934314505 2:91904234-91904256 CTGGGTAAATAACAAAATGAAGG + Intergenic
934999962 2:99003705-99003727 CTGGGTAAATAACGAGATGAAGG + Intronic
935083658 2:99823986-99824008 CAGGCTCACTACCTAGATGAGGG + Intronic
935567675 2:104626951-104626973 CTGGGTAAATAACAAAATGAAGG - Intergenic
936430075 2:112455054-112455076 CTGGCTAATTAATATGATTAGGG - Intergenic
936823785 2:116555681-116555703 CTGGCTACATAACAAAATGAAGG + Intergenic
937192580 2:120118453-120118475 CTGGCTTAATACCCAGGTGATGG - Intronic
938704751 2:133913246-133913268 CTGGCTACATAACAAAATGAAGG + Intergenic
938975327 2:136471593-136471615 CTGGGTAAATAACAAAATGAAGG + Intergenic
939193129 2:138940171-138940193 CTGGCTAAATAACGAAATGAAGG - Intergenic
939753324 2:146076176-146076198 CTGGGTAAATAACAAAATGAAGG + Intergenic
940703044 2:157070494-157070516 CTGGATAAATAACAAAATGAAGG + Intergenic
940824772 2:158398528-158398550 CTGGGTAAATAACAAAATGAAGG + Intronic
941239039 2:163014331-163014353 CTGGGTAAATACCAAAATTAAGG - Intergenic
942669152 2:178354987-178355009 CTGGGTAATTAACGAAATGAAGG + Intronic
942875088 2:180785646-180785668 CTGGGTAAATAACAAAATGAAGG - Intergenic
944249328 2:197565720-197565742 CTGGGTAAATAACAAAATGAAGG - Intergenic
944375014 2:199031338-199031360 CTGGGTAAATAACAAAATGAAGG + Intergenic
944968608 2:204965367-204965389 ATGCCTAATCAACAAGATGACGG - Intronic
945116506 2:206413301-206413323 CTGGGTAAATACCGAAATGAAGG - Intergenic
945165056 2:206934668-206934690 GTGGCTAATTCCCAAGCTGATGG + Intergenic
945212749 2:207400558-207400580 CAGGCTTAATACCTAGATGATGG + Intergenic
947068077 2:226252978-226253000 CTGGCTAAATAACACAATGAAGG + Intergenic
947494321 2:230622499-230622521 CTGGGTAAATAACAAAATGAAGG + Intergenic
948669236 2:239556537-239556559 CTGGCTTAATACCTAGGTGATGG - Intergenic
1169722602 20:8695395-8695417 CTGGCTATTTAAAAAAATGATGG + Intronic
1170186483 20:13596432-13596454 CTGGGTAAATAACAAAATGAAGG + Intronic
1170555183 20:17509116-17509138 CTAACTAACTCCCAAGATGAAGG + Intronic
1171039654 20:21748912-21748934 CTGGGTAAATAGCAAAATGAAGG - Intergenic
1171273895 20:23838367-23838389 CTGGGTAAATAACAAAATGAAGG + Intergenic
1171513869 20:25711744-25711766 CTGGGTAAATAGCAAAATGAAGG - Intergenic
1174123269 20:48283423-48283445 CTCGCTCATTACCAAGGGGATGG + Intergenic
1174877274 20:54240911-54240933 CTGGGTAAATAACAAAATGAAGG + Intergenic
1175071714 20:56339666-56339688 CTGGGTAAATAACAAAATGAAGG + Intergenic
1176992907 21:15520784-15520806 CTGGCTCTTTTCCAGGATGAGGG - Intergenic
1177205557 21:18006256-18006278 TGGGCTTAATACCAAGATGATGG + Intronic
1177261710 21:18737886-18737908 CTGATTGATTACCTAGATGAAGG + Intergenic
1177407243 21:20685810-20685832 CTGGATATTTACCAAGAAGATGG - Intergenic
1177460849 21:21408131-21408153 TTGCCTAATGACCATGATGAGGG + Intronic
1177721888 21:24917831-24917853 CTGGGTAAATAACAAAATGAAGG - Intergenic
1177725642 21:24963463-24963485 CTGGCTTAATACCAAGGTGATGG - Intergenic
1181236082 22:21448379-21448401 CTGGCTAATTACCAAGATGAGGG - Exonic
1181445496 22:22969921-22969943 CTGGGTAAATAACAAAATGAAGG + Intergenic
1203324318 22_KI270737v1_random:103116-103138 CTGGGTAAATAACAAAATGAAGG - Intergenic
949440430 3:4074240-4074262 CTGGATAAATAACAAAATGAAGG + Intronic
949800236 3:7896055-7896077 CTGGCTTAATAACAAAATGAAGG - Intergenic
950469541 3:13175922-13175944 CAAGCTAATTACCCAGGTGATGG - Intergenic
951143381 3:19195659-19195681 CTGGGTAATTATCAAGTAGATGG - Intronic
951361087 3:21725083-21725105 CTGGATAAATAACAAAATGAGGG + Intronic
951450241 3:22829224-22829246 CTGGGTAAATAACAAAATGAAGG + Intergenic
952550310 3:34469540-34469562 CTGGGTAAATAACAAAATGAAGG - Intergenic
952620092 3:35327871-35327893 CTCACTTATTACCAAGTTGATGG + Intergenic
954833474 3:53443979-53444001 CTGGGTACATACCAAAATGAAGG - Intergenic
954900866 3:54018419-54018441 CTGGCTTAATACCGAGGTGATGG + Intergenic
956555342 3:70515637-70515659 CTGGTTAATCACCAAGATGTTGG - Intergenic
956668702 3:71665850-71665872 CTGGGTAAATAACAAAATGAAGG + Intergenic
956862204 3:73336093-73336115 CTGGGTAAATAACAAAATGAAGG - Intergenic
957190172 3:76997920-76997942 CTGGCTAGTTTCCTAGATGATGG - Intronic
957353056 3:79050810-79050832 CTGGGTAAATAACAAAATGAAGG + Intronic
957727776 3:84089509-84089531 CTGGGTACTTAACAAAATGAAGG + Intergenic
957917598 3:86706568-86706590 CTGGGTAAATAACAAAATGAAGG - Intergenic
958191504 3:90190889-90190911 CTGGGTAAATAACAAAATGAAGG - Intergenic
958742634 3:98093638-98093660 CTGGGTAAATAACAAAATGAAGG - Intergenic
959816075 3:110674477-110674499 CTGGGTAAATAACAAAATGAAGG + Intergenic
960065647 3:113369479-113369501 CTGGGTAAATAACAAAATGAAGG + Intronic
960787434 3:121389625-121389647 CTGGGTAAATAACAAAATGAAGG - Intronic
960832106 3:121860911-121860933 CTGGGTAAATAACAAAATGAAGG - Intronic
960835788 3:121905589-121905611 CTGGGTAAATAACAAAATGAAGG - Intronic
961992803 3:131210224-131210246 CTGGGTAAATAACAAAATGAAGG - Intronic
962157141 3:132959626-132959648 CTGGGTAAATAACAAAATGAAGG + Intergenic
962819020 3:139028829-139028851 CTGGGTAAATAACAAAATGAAGG + Intronic
962861570 3:139407480-139407502 CTGGGTAAATAACAAAATGAAGG + Intergenic
963531778 3:146479987-146480009 CTGGGTAAATAACAAAATGAAGG + Intronic
964995281 3:162870720-162870742 CTGGATAAATAACAAAATGAAGG + Intergenic
965325036 3:167292451-167292473 CTGGGTAAATAACAAAATGAAGG + Intronic
965393310 3:168131188-168131210 CTGGGTAAATAACAAAATGAAGG + Intergenic
967096828 3:186184173-186184195 ATGGCTTATTAGGAAGATGATGG - Intronic
967343380 3:188426192-188426214 CTGGGTAAATAACAAAATGAAGG - Intronic
967629860 3:191732968-191732990 CTGGGTAAATAACAAAATGAAGG + Intergenic
968455048 4:693418-693440 CTGTCTATTTACTTAGATGAGGG + Intergenic
970917736 4:21355052-21355074 CTGGGTAAATAACAAAATGAAGG + Intronic
971263863 4:25081176-25081198 CTCACTCATTACCAAGAGGAGGG - Intergenic
972914581 4:43860057-43860079 CTGGGTAAATAACAAAATGAAGG - Intergenic
973799545 4:54462999-54463021 CTGGGTAAATAACAAAATGAAGG + Intergenic
974023934 4:56715513-56715535 CTGGGTAAATAACAAAATGAAGG + Intergenic
975048867 4:69834099-69834121 CTGGATAATTACCAATATGTAGG - Intronic
975306358 4:72853672-72853694 CTGGGTAAATAACAAAATGAAGG + Intergenic
975500303 4:75077468-75077490 CTGGGTAAATAACAAAATGAAGG - Intergenic
975750843 4:77521950-77521972 CTGGGTAAATAACAAAATGAAGG - Intronic
976159830 4:82187017-82187039 CTGGGTAAATAACAAAATGAAGG + Intergenic
976272354 4:83243700-83243722 CTGGGTAAATAACAAAATGAAGG + Intergenic
976760324 4:88541847-88541869 CTGGGTAAATAACAAAATGAAGG + Intronic
976861770 4:89674203-89674225 CTGGGTAAATAACAAAATGAAGG + Intergenic
977055873 4:92189653-92189675 CTTGCTCATTACCAAGAGGATGG + Intergenic
977291954 4:95174483-95174505 CTGGGTAAATAACAAAATGAAGG - Intronic
977318286 4:95478861-95478883 CTTGCTGATTACCATGATAAAGG - Intronic
977515944 4:98021259-98021281 CTGGGTAAATAACAAAATGAAGG - Intronic
977516987 4:98032844-98032866 CTGGGTAAATAACAAAATGAAGG + Intronic
977771462 4:100866045-100866067 CTGGGTAAATAACAAAATGAAGG - Intronic
977946738 4:102922311-102922333 CTGGGTAAATAACAAAATGAAGG + Intronic
978115670 4:105017478-105017500 CTGGGTAAATAACAAAATGAAGG + Intergenic
978658713 4:111097880-111097902 CTGGCTACGTAACAAAATGAAGG - Intergenic
978773059 4:112477823-112477845 CTGGGTAAATAACAAAATGAAGG - Intergenic
979031438 4:115653415-115653437 CTGGGTAAATAACAAAATGAAGG - Intergenic
979315103 4:119252974-119252996 CTGGGTAACTAACAAAATGAAGG - Intronic
979752159 4:124291897-124291919 CTCGCTTATCACCAAGATGATGG - Intergenic
979757870 4:124364126-124364148 CTGGCTAAATAACGAAATGAAGG + Intergenic
979977952 4:127220088-127220110 CTCACTGATTACCAAGAAGATGG - Intergenic
980037550 4:127902741-127902763 CTGGGTAAATAACAAAATGAAGG - Intergenic
981508111 4:145525503-145525525 CTGGCAAATTAACAAAATGTGGG - Intronic
982962104 4:161852887-161852909 CAGGCTTAATACCAAGGTGATGG + Intronic
983694165 4:170508329-170508351 CTGGGTAAATAACAAAATGAAGG - Intergenic
984224673 4:177020110-177020132 CTGGGTAAATAACAAAATGAAGG + Intergenic
985166283 4:187098520-187098542 TTGGCTTAATACCTAGATGATGG - Intergenic
985473521 5:63335-63357 CTGGGTAAATAACAAAATGAAGG - Intergenic
986502234 5:8413138-8413160 CTGGCTGATCACTAAGAGGATGG - Intergenic
987180172 5:15359019-15359041 CTGGGTAAATAACAAAATGAAGG + Intergenic
987492512 5:18598618-18598640 CTCACTTATTACCAAGGTGATGG - Intergenic
987949554 5:24657943-24657965 CTGGATAAATAGCAAAATGAAGG - Intergenic
988172539 5:27678273-27678295 CTGGGTAAATAACAAAATGAAGG + Intergenic
988671996 5:33391583-33391605 CTGGATAAATAACAAAATGAAGG + Intergenic
989009131 5:36850189-36850211 CTGGATAAATAACAAAATGAAGG + Intergenic
989345025 5:40420441-40420463 CTGGGTAAATAACAAAATGAAGG - Intergenic
989670889 5:43915655-43915677 CTGGGTAAATAACAAAATGAAGG - Intergenic
989959162 5:50389881-50389903 CTGGATAAATAACAAAATGAAGG + Intergenic
990224016 5:53629119-53629141 CTGGGTAAATAACAAAATGAAGG - Intronic
990993862 5:61711809-61711831 CTGGCTTAATACCTAGGTGATGG + Intronic
991199741 5:63978126-63978148 CTGGCTAAATAACGAAATGAAGG - Intergenic
993291734 5:86080859-86080881 CTGGGTAAATAACAAAATGAAGG - Intergenic
993497167 5:88620686-88620708 CTGGGTAAATAACAAAATGATGG - Intergenic
993656044 5:90579346-90579368 CTGGGTAAATAACAAAATGAAGG - Intronic
993674237 5:90797829-90797851 CTGGGTAAATAACAAAATGAAGG + Intronic
994039977 5:95247631-95247653 CTGGGTAAATAACAAAATGAAGG - Intronic
994345645 5:98682685-98682707 CTGGGTAAATAACAAAATGAAGG + Intergenic
994378363 5:99040525-99040547 CTGGGTAAATAACAAAATGAAGG + Intergenic
995106795 5:108384006-108384028 CTGGATAAATACCTAGATGTGGG - Intergenic
995108548 5:108402134-108402156 CTGGGTAAATAACAAAATGAAGG + Intergenic
995460011 5:112392991-112393013 CTGGGTAAATAACAAAATGAAGG + Intronic
995471490 5:112506437-112506459 CTGGCTAAATAACAAAATTAAGG + Intergenic
997012168 5:129891647-129891669 CTGGGTAAATAACAAAATGAAGG - Intergenic
997343641 5:133168446-133168468 CTGGGTAAATAACAAAATGAAGG - Intergenic
997351676 5:133235527-133235549 CTGGCTAATTAGCTGGATGAAGG + Intronic
997903034 5:137785840-137785862 CTGGCTAAATAACAAAATGAAGG + Intergenic
999557077 5:152754850-152754872 CTGGGTAAATAACAAAATGAAGG + Intergenic
1000447948 5:161347613-161347635 CTGGCTAGCTGCCATGATGAAGG - Intronic
1001136386 5:169106098-169106120 CTGGCTTAATACCTAGGTGATGG + Intronic
1001983619 5:176054640-176054662 CTGGCTACATAACAAAATGAAGG + Intronic
1001986824 5:176081410-176081432 CTGGCTACATAACAAAATGAAGG - Intronic
1002230046 5:177756737-177756759 CTGGCTACATAACAAAATGAAGG + Intronic
1002233850 5:177789412-177789434 CTGGCTACATAACAAAATGAAGG - Intronic
1002265297 5:178027040-178027062 CTGGCTACATAACAAAATGAAGG - Intronic
1003127518 6:3367400-3367422 CTTGCTAACGCCCAAGATGATGG - Intronic
1003228925 6:4231891-4231913 CTGGGTAAATAACAAAATGAAGG + Intergenic
1005747462 6:28851667-28851689 CTGGGTAAATAACAAAATGAAGG + Intergenic
1008088820 6:47272416-47272438 CTGGGTAAATAACAAAATGAAGG + Intronic
1008207639 6:48682863-48682885 CTGGGTAAATAACAAAATGAAGG + Intergenic
1008436596 6:51483613-51483635 CTGGGTAAATAACAAAATGAAGG - Intergenic
1008865707 6:56206940-56206962 CTGGGTAAATAACAAAATGAAGG + Intronic
1008961563 6:57271868-57271890 CTGGGTAAATAACAAAATGAAGG - Intergenic
1009241063 6:61186360-61186382 CTGGGTAAATAACAAAATGAAGG + Intergenic
1009384602 6:63073504-63073526 CTGGGTAAATAACAAAATGAAGG - Intergenic
1009393510 6:63169861-63169883 CTGGGTAAATAACAAAATGAAGG + Intergenic
1009628914 6:66169370-66169392 CTGGGTAAATAACAAAATGAAGG + Intergenic
1009877048 6:69517904-69517926 CTGGGTAAATAACAAAATGAAGG + Intergenic
1010006515 6:71000896-71000918 CTGGGTAAATAACAAAATGAAGG + Intergenic
1010459723 6:76100285-76100307 CTGGGTAAATAACAAAATGAAGG + Intergenic
1010887059 6:81256862-81256884 CTGGATAAATAACAAAATGAAGG + Intergenic
1011209445 6:84938895-84938917 CTGGGTAAATAACAAAATGAAGG + Intergenic
1011213783 6:84982942-84982964 CTGGGTAAATAACAAAATGAAGG + Intergenic
1011235316 6:85210389-85210411 CTGGGTAAATAACAAAATGAAGG - Intergenic
1011235767 6:85214696-85214718 CTGGGTAAATAACAAAATGAAGG + Intergenic
1011988440 6:93480795-93480817 CTGGGTAAATATCAAAATGAAGG + Intergenic
1012266173 6:97145976-97145998 CTGGCTAAAGAGCAAGAAGATGG + Exonic
1013319952 6:108978239-108978261 CTGGGTAAATAACAAAATGAAGG - Intergenic
1013860618 6:114631241-114631263 CTGGGTAAATAACAAAATGAAGG - Intergenic
1013906417 6:115224959-115224981 CTGGGTAAATAACAAAATGAAGG + Intergenic
1013952840 6:115805702-115805724 CTGGCTTAATACCTAGGTGATGG + Intergenic
1013957447 6:115856869-115856891 CTGGGTAAATAACAAAATGAAGG + Intergenic
1014128215 6:117801922-117801944 CTGGGTAAATAACAAAATGAAGG - Intergenic
1015967444 6:138709153-138709175 CTGGGTAAATAACAAGATGAAGG - Intergenic
1016557704 6:145358159-145358181 TGGGCTTATTACCTAGATGATGG + Intergenic
1016655378 6:146512895-146512917 CTGGGTAAATAACAAAATGAAGG - Intergenic
1017231853 6:152081376-152081398 CTGGGTAAATAACAAAATGAAGG + Intronic
1017279898 6:152611898-152611920 CTGGGTAAATAACAAAATGAAGG + Intronic
1017303155 6:152885541-152885563 CTGGGTAAATAACAAAATGAAGG + Intergenic
1017411779 6:154175073-154175095 CTGGGTAAATAACAAAATGAAGG + Intronic
1020609338 7:10375440-10375462 CTGGGTAAATAACAAAATGAAGG + Intergenic
1020659248 7:10963321-10963343 CTGGGTAAATAACAAAATGAAGG - Intergenic
1020810252 7:12842435-12842457 CTGGGTAAATAGCAAAATGAAGG + Intergenic
1020833776 7:13124069-13124091 CTGGGTAAATAACAAAATGATGG - Intergenic
1021166718 7:17351699-17351721 CTGGGTAAATAACAAAATGAAGG - Intergenic
1021238475 7:18172691-18172713 CTGGGTAAATAACAAAATGAAGG - Intronic
1021502023 7:21342592-21342614 CTGGGTAAATAACAAAATGAAGG - Intergenic
1021642623 7:22754604-22754626 CTGGGTAATTAACAAAATTAAGG - Intergenic
1021749068 7:23777062-23777084 CTGGGTAATTAACAAAATTAAGG - Intronic
1021750816 7:23797512-23797534 CTGGGTAATTAACAAAATTAAGG + Intronic
1021836814 7:24685050-24685072 TGGGCTAAATACCTAGATGATGG - Intronic
1021949776 7:25763267-25763289 CTGTCTAATGACCAGAATGATGG - Intergenic
1023482652 7:40650810-40650832 CTGGCTTAATACCTAGGTGATGG - Intronic
1024372634 7:48604471-48604493 CTGGGTAAATAACAAAATGAAGG - Intronic
1026451255 7:70531648-70531670 CTGACTCATCACCAAGAGGATGG + Intronic
1026488434 7:70841074-70841096 CTGGGTAAATAACAAAATGAAGG + Intergenic
1027702041 7:81481313-81481335 CTGGGTAAATAACAAAATGAAGG + Intergenic
1027777939 7:82489989-82490011 CTGGGTAAATAACAAAATGAAGG - Intergenic
1028369319 7:90072853-90072875 CTGGGTAAATAACAAAATGAAGG + Intergenic
1028751269 7:94385661-94385683 CTGCTTAATTACCAAGAGAATGG + Intergenic
1028786238 7:94797277-94797299 CTGGGTAAATAACAAAATGAAGG + Intergenic
1028802722 7:94985073-94985095 CTGGGTAAATAACAAAATGAAGG - Intronic
1029006270 7:97213279-97213301 CTGGGTAAATAACAAAATGAAGG - Intergenic
1029053097 7:97710253-97710275 CTGGGTAAATAACAAAATGAAGG - Intergenic
1029313437 7:99688918-99688940 CTGGCTACATAACAAAATGAAGG + Intronic
1029850303 7:103454770-103454792 CTGGCTAAATAACAAAATAAAGG - Intergenic
1031285167 7:119857689-119857711 CTGGCTACATAACAAAATGAAGG + Intergenic
1031316506 7:120264396-120264418 CTGGCTCATTACCACAATCAAGG + Intergenic
1031366242 7:120903602-120903624 CTGGGTAAATAACAAAATGAAGG + Intergenic
1031391795 7:121224199-121224221 CTGGGTAAATAACAAAATGAAGG - Intronic
1031902374 7:127425688-127425710 CTGGGTAAATAACAAAATGAAGG - Intronic
1032603781 7:133327678-133327700 CTGGGTAAATAACAAAATGAAGG - Intronic
1032659454 7:133967568-133967590 CTGGGTAAATAACAAAATGAAGG - Intronic
1032764604 7:134978890-134978912 CTGGGTAAATAACAAAATGAAGG + Intergenic
1033478264 7:141711965-141711987 CTGGTTCATTACCATGAGGATGG + Intronic
1034394458 7:150810456-150810478 CTGGGTAAATAACAAAATGAAGG + Intergenic
1037664815 8:20959108-20959130 CTGGGTAAATAACAAAATGAAGG + Intergenic
1039036302 8:33363170-33363192 CTGGTTAAATAACAAAATGAAGG + Intergenic
1039676501 8:39673863-39673885 CTGGGTAAATAACAAAATGAAGG - Intronic
1040411051 8:47154614-47154636 CTGGGTAAATAACAAAATGAAGG + Intergenic
1040431480 8:47347187-47347209 CTGGGTAAATAACAAAATGAAGG - Intronic
1041145273 8:54869847-54869869 CTAGATGAGTACCAAGATGATGG + Intergenic
1041269625 8:56098654-56098676 CTCACTTATTACCAAGACGATGG - Intergenic
1041583687 8:59492371-59492393 CTGGGTAAATAACAACATGAAGG - Intergenic
1041750143 8:61252157-61252179 CTGGGTAAATAACAAAATGAAGG - Intronic
1043081403 8:75769804-75769826 CTGGGTAAATAACAAAATGATGG - Intergenic
1043165603 8:76899316-76899338 CTGGGTAAATAACAAAATGAAGG - Intergenic
1043604880 8:81988320-81988342 CTGGGTAAATAACAAAATGAAGG - Intergenic
1044103642 8:88173835-88173857 TTGGCTATTTCCCAAGATGCTGG + Intronic
1044786581 8:95800286-95800308 CTGGCTTAATACCTAGCTGATGG + Intergenic
1045125485 8:99084694-99084716 CTGGCTACATAACAAAATGAAGG - Intronic
1045928100 8:107594521-107594543 CTGGGTAAATAACGAGATGAAGG - Intergenic
1047129605 8:122004153-122004175 CTGGGTAAATAACAAAATGAAGG + Intergenic
1047816443 8:128469088-128469110 TTGGTTAATTATTAAGATGATGG - Intergenic
1048149540 8:131880941-131880963 CTGGGTAAATAGCAAAATGAAGG - Intergenic
1048858711 8:138706538-138706560 CTGGCTACATAACAAAATGAAGG + Intronic
1050478006 9:6060891-6060913 CTGGCTACATAACGAGATGAAGG - Intergenic
1051181575 9:14417494-14417516 CTGGACACCTACCAAGATGATGG + Intergenic
1051309084 9:15749723-15749745 CTGGGTAAATAACAAAATGAAGG + Intronic
1051549003 9:18308094-18308116 CTGGGTAAATAACAAAATGAAGG + Intergenic
1051670193 9:19502369-19502391 CTGGGTAAATAACAAAATGAAGG - Intergenic
1052134357 9:24891652-24891674 CTGGGTAAATATCAAAATGAAGG + Intergenic
1052412748 9:28143605-28143627 CTGGATAATGACTAAGAAGATGG + Intronic
1055184331 9:73432539-73432561 CAGACTAATTTCCAGGATGAAGG - Intergenic
1055310325 9:74972851-74972873 CTGGGTAAATAACAAAATGAAGG - Intergenic
1055745703 9:79441724-79441746 CTGGCTACGTAACAAAATGAAGG + Intergenic
1056016076 9:82389412-82389434 CTGGGTAAATAACAAAATGAAGG - Intergenic
1056379159 9:86041649-86041671 CTGGCAAATTATCAAACTGAGGG + Intronic
1056397090 9:86191994-86192016 CTCACTTATTACCAAGAGGATGG - Intergenic
1056631113 9:88293850-88293872 CTGGCAAATTATCAAACTGAAGG - Intergenic
1056668338 9:88600216-88600238 CTGGGTAAATAACAAAATGAAGG + Intergenic
1058202729 9:102064418-102064440 CTGGATAAATAACAAAATGAAGG - Intergenic
1058516362 9:105780295-105780317 CTGGATACATAACAAGATGAAGG - Intergenic
1059573693 9:115467896-115467918 CTGGATAACTACAAAGATCAAGG + Intergenic
1059881545 9:118695873-118695895 CTTGCTTATCACCAAGAGGATGG + Intergenic
1203688452 Un_GL000214v1:18881-18903 CTGGCTAAATAACGAAATGAAGG + Intergenic
1203647823 Un_KI270751v1:85172-85194 CTGGCTAAATAACGAAATGAAGG - Intergenic
1186319060 X:8404284-8404306 CTGGGAAATTTTCAAGATGAGGG + Intergenic
1186688001 X:11945740-11945762 CTCACTCATTACCAAGAGGATGG + Intergenic
1188020648 X:25153329-25153351 ATGGCTATTTACCAGGATGCAGG + Intergenic
1188036726 X:25326405-25326427 CTGGCTTAATACCTAGGTGATGG - Intergenic
1188201977 X:27302423-27302445 CTGGATAATTAACAAAATTAAGG + Intergenic
1188406486 X:29816905-29816927 CTGTCTTATTACCAAGATAATGG + Intronic
1189618810 X:42813914-42813936 CTGGATAAATAACAAAATGAAGG - Intergenic
1189772320 X:44438664-44438686 CTCACTAATTACCAAGAAGATGG - Intergenic
1189978144 X:46483301-46483323 CTGGGTAAATAACAAAATGAAGG - Intronic
1191003910 X:55689783-55689805 CTGGGTAAATAACAAAATGAAGG + Intergenic
1191122235 X:56918373-56918395 CTGGGTAACTAACAAAATGAAGG - Intergenic
1191198169 X:57747028-57747050 CTGGGTAAATAACAAAATGAAGG + Intergenic
1191821035 X:65308889-65308911 CTGGGTAAATAACAAAATGAAGG + Intergenic
1191824455 X:65349267-65349289 CTGGGTAAATAACAAAATGAAGG + Intergenic
1191967702 X:66778163-66778185 CTGGCACATTAACCAGATGAGGG - Intergenic
1192133949 X:68579518-68579540 CTGGGTAAATAACAAAATGAAGG - Intergenic
1192393910 X:70758520-70758542 CTGGGTAAATAACAAAATGAAGG + Intronic
1192396159 X:70783231-70783253 CTGGGTAAATAACAAAATGAAGG + Intronic
1192636874 X:72828443-72828465 CTGGCTAAATAACGAAATGAAGG - Intronic
1192644840 X:72892371-72892393 CTGGCTAAATAACGAAATGAAGG + Intronic
1192678559 X:73226755-73226777 CTGGGTAAATAACAAAATGAAGG + Intergenic
1192695013 X:73404254-73404276 CTGGATAAATAACAAAATGAAGG + Intergenic
1192937757 X:75878893-75878915 CTGGGTAAATAACAAAATGAAGG - Intergenic
1192964462 X:76162223-76162245 CTGGGTAAATAGCAAAATGAAGG + Intergenic
1193402865 X:81066551-81066573 CTGGGTAAATAACAAAATGAAGG + Intergenic
1193445924 X:81602434-81602456 CTGGGTAAATAACAAAATGAAGG - Intergenic
1193542721 X:82791215-82791237 CTGGATAAATAACAAAATGAAGG + Intergenic
1193575240 X:83186931-83186953 CTGGCTAACTATCAAGATGGCGG - Intergenic
1193733599 X:85130887-85130909 CTGGGTAAATAACAAAATGAAGG - Intergenic
1193879086 X:86899690-86899712 CTGGGTAAATAGCAAAATGAAGG - Intergenic
1193949874 X:87784635-87784657 CTCACTAATTACCAAGAAGATGG + Intergenic
1194189588 X:90818452-90818474 CAGGCTTAATAACAAGATGATGG - Intergenic
1195163069 X:102190214-102190236 CTGGGTAAATAACAAAATGAAGG - Intergenic
1195580011 X:106491054-106491076 CTGGGTAAATAACAAAATGAAGG - Intergenic
1195846224 X:109231689-109231711 CTGGGTAAATAACAAAATGAAGG + Intergenic
1195988603 X:110659785-110659807 CTGGGTAAATAACAAAATGAAGG + Intergenic
1196094789 X:111787307-111787329 CTGGGTAAATAACAAAATGAAGG + Intronic
1196252845 X:113482157-113482179 CTGGCTACATAACAAAATGAAGG + Intergenic
1196575115 X:117307934-117307956 CTGGGTAAATAACAAAATGAAGG + Intergenic
1196589146 X:117465431-117465453 CTGGGTAAATAACAAAATGAAGG - Intergenic
1197556321 X:127959411-127959433 TTGGCTAATTAGAAAGCTGAAGG + Intergenic
1198266047 X:135009887-135009909 CTGGATTATTAACAAGATGAGGG + Intergenic
1198266126 X:135010606-135010628 CTGGATTATCACCAAGGTGAAGG + Intergenic
1198266209 X:135011334-135011356 CTGGATTATCACCAAGATGAAGG + Intergenic
1198266290 X:135012063-135012085 CTGGATTATGACCAAGATGAGGG + Intergenic
1198335548 X:135662755-135662777 CTGGGTAAATAGCAAAATGAAGG - Intergenic
1199384030 X:147203189-147203211 CTGGGTAAATAACAAAATGAAGG + Intergenic
1199436888 X:147822299-147822321 CTGGGTAAATAACAAAATGAAGG + Intergenic
1199951583 X:152711177-152711199 CTGCTGAATTACCAAGGTGATGG + Intergenic
1199958100 X:152757271-152757293 CTGCTGAATTACCAAGGTGATGG - Intergenic
1200257700 X:154593363-154593385 CTCGCTCATCACCAAGAGGATGG - Intergenic
1200269488 X:154668661-154668683 CTGGGTAAATAACAAAATGAAGG - Intergenic
1200696138 Y:6362530-6362552 CTGGCAAACTCCCAAGTTGAGGG - Intergenic
1200910308 Y:8525969-8525991 CTGGCAAATTCCCAATTTGAGGG + Intergenic
1200939309 Y:8765669-8765691 CTGGCTAAATCCCAATTTGAGGG - Intergenic
1201037976 Y:9802172-9802194 CTGGCAAACTCCCAAGTTGAGGG + Intergenic
1201182419 Y:11361697-11361719 CTGGGTAAATAACAAGATGAAGG + Intergenic
1201929888 Y:19331441-19331463 CAGGCTTATTACCTAGCTGATGG + Intergenic
1202044118 Y:20720139-20720161 CTGGGTAAATAACAAAATGAAGG + Intergenic
1202174908 Y:22088920-22088942 CTGGGTAAATAACAAAATGAAGG + Intronic
1202216454 Y:22497462-22497484 CTGGGTAAATAACAAAATGAAGG - Intronic
1202326734 Y:23698607-23698629 CTGGGTAAATAACAAAATGAAGG + Intergenic
1202544035 Y:25971446-25971468 CTGGGTAAATAACAAAATGAAGG - Intergenic