ID: 1181237479

View in Genome Browser
Species Human (GRCh38)
Location 22:21456405-21456427
Sequence AAGAGGAGCTGAACATGAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181237479_1181237484 12 Left 1181237479 22:21456405-21456427 CCTATTCATGTTCAGCTCCTCTT No data
Right 1181237484 22:21456440-21456462 AACAATGAGTTGCCTCCTGCAGG No data
1181237479_1181237485 13 Left 1181237479 22:21456405-21456427 CCTATTCATGTTCAGCTCCTCTT No data
Right 1181237485 22:21456441-21456463 ACAATGAGTTGCCTCCTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181237479 Original CRISPR AAGAGGAGCTGAACATGAAT AGG (reversed) Intergenic
No off target data available for this crispr