ID: 1181237482

View in Genome Browser
Species Human (GRCh38)
Location 22:21456422-21456444
Sequence TTGTTACCTTGGCCAGAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181237482_1181237485 -4 Left 1181237482 22:21456422-21456444 CCTCTTTCTGGCCAAGGTAACAA No data
Right 1181237485 22:21456441-21456463 ACAATGAGTTGCCTCCTGCAGGG No data
1181237482_1181237488 15 Left 1181237482 22:21456422-21456444 CCTCTTTCTGGCCAAGGTAACAA No data
Right 1181237488 22:21456460-21456482 AGGGTCCCTGCTGTGAAATCAGG No data
1181237482_1181237484 -5 Left 1181237482 22:21456422-21456444 CCTCTTTCTGGCCAAGGTAACAA No data
Right 1181237484 22:21456440-21456462 AACAATGAGTTGCCTCCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181237482 Original CRISPR TTGTTACCTTGGCCAGAAAG AGG (reversed) Intergenic
No off target data available for this crispr