ID: 1181237483

View in Genome Browser
Species Human (GRCh38)
Location 22:21456433-21456455
Sequence GAGGCAACTCATTGTTACCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181237483_1181237492 30 Left 1181237483 22:21456433-21456455 CCAAGGTAACAATGAGTTGCCTC No data
Right 1181237492 22:21456486-21456508 TCCCGTGCTTCTCGATCAGCAGG No data
1181237483_1181237488 4 Left 1181237483 22:21456433-21456455 CCAAGGTAACAATGAGTTGCCTC No data
Right 1181237488 22:21456460-21456482 AGGGTCCCTGCTGTGAAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181237483 Original CRISPR GAGGCAACTCATTGTTACCT TGG (reversed) Intergenic
No off target data available for this crispr