ID: 1181237484

View in Genome Browser
Species Human (GRCh38)
Location 22:21456440-21456462
Sequence AACAATGAGTTGCCTCCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181237479_1181237484 12 Left 1181237479 22:21456405-21456427 CCTATTCATGTTCAGCTCCTCTT No data
Right 1181237484 22:21456440-21456462 AACAATGAGTTGCCTCCTGCAGG No data
1181237482_1181237484 -5 Left 1181237482 22:21456422-21456444 CCTCTTTCTGGCCAAGGTAACAA No data
Right 1181237484 22:21456440-21456462 AACAATGAGTTGCCTCCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181237484 Original CRISPR AACAATGAGTTGCCTCCTGC AGG Intergenic
No off target data available for this crispr