ID: 1181237488

View in Genome Browser
Species Human (GRCh38)
Location 22:21456460-21456482
Sequence AGGGTCCCTGCTGTGAAATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181237482_1181237488 15 Left 1181237482 22:21456422-21456444 CCTCTTTCTGGCCAAGGTAACAA No data
Right 1181237488 22:21456460-21456482 AGGGTCCCTGCTGTGAAATCAGG No data
1181237483_1181237488 4 Left 1181237483 22:21456433-21456455 CCAAGGTAACAATGAGTTGCCTC No data
Right 1181237488 22:21456460-21456482 AGGGTCCCTGCTGTGAAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181237488 Original CRISPR AGGGTCCCTGCTGTGAAATC AGG Intergenic
No off target data available for this crispr