ID: 1181237492

View in Genome Browser
Species Human (GRCh38)
Location 22:21456486-21456508
Sequence TCCCGTGCTTCTCGATCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181237490_1181237492 -3 Left 1181237490 22:21456466-21456488 CCTGCTGTGAAATCAGGCCATCC No data
Right 1181237492 22:21456486-21456508 TCCCGTGCTTCTCGATCAGCAGG No data
1181237487_1181237492 8 Left 1181237487 22:21456455-21456477 CCTGCAGGGTCCCTGCTGTGAAA No data
Right 1181237492 22:21456486-21456508 TCCCGTGCTTCTCGATCAGCAGG No data
1181237489_1181237492 -2 Left 1181237489 22:21456465-21456487 CCCTGCTGTGAAATCAGGCCATC No data
Right 1181237492 22:21456486-21456508 TCCCGTGCTTCTCGATCAGCAGG No data
1181237486_1181237492 11 Left 1181237486 22:21456452-21456474 CCTCCTGCAGGGTCCCTGCTGTG No data
Right 1181237492 22:21456486-21456508 TCCCGTGCTTCTCGATCAGCAGG No data
1181237483_1181237492 30 Left 1181237483 22:21456433-21456455 CCAAGGTAACAATGAGTTGCCTC No data
Right 1181237492 22:21456486-21456508 TCCCGTGCTTCTCGATCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181237492 Original CRISPR TCCCGTGCTTCTCGATCAGC AGG Intergenic