ID: 1181238119

View in Genome Browser
Species Human (GRCh38)
Location 22:21460344-21460366
Sequence CCAGGTAAACCCTCGGACGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181238113_1181238119 -6 Left 1181238113 22:21460327-21460349 CCTCACTGTGATCATCCCCAGGT No data
Right 1181238119 22:21460344-21460366 CCAGGTAAACCCTCGGACGTGGG No data
1181238111_1181238119 -3 Left 1181238111 22:21460324-21460346 CCACCTCACTGTGATCATCCCCA No data
Right 1181238119 22:21460344-21460366 CCAGGTAAACCCTCGGACGTGGG No data
1181238107_1181238119 19 Left 1181238107 22:21460302-21460324 CCGTGAGGTCCTGTTGAGCCACC No data
Right 1181238119 22:21460344-21460366 CCAGGTAAACCCTCGGACGTGGG No data
1181238105_1181238119 30 Left 1181238105 22:21460291-21460313 CCAGGCCAGCGCCGTGAGGTCCT No data
Right 1181238119 22:21460344-21460366 CCAGGTAAACCCTCGGACGTGGG No data
1181238108_1181238119 10 Left 1181238108 22:21460311-21460333 CCTGTTGAGCCACCCACCTCACT No data
Right 1181238119 22:21460344-21460366 CCAGGTAAACCCTCGGACGTGGG No data
1181238110_1181238119 -2 Left 1181238110 22:21460323-21460345 CCCACCTCACTGTGATCATCCCC No data
Right 1181238119 22:21460344-21460366 CCAGGTAAACCCTCGGACGTGGG No data
1181238109_1181238119 1 Left 1181238109 22:21460320-21460342 CCACCCACCTCACTGTGATCATC No data
Right 1181238119 22:21460344-21460366 CCAGGTAAACCCTCGGACGTGGG No data
1181238106_1181238119 25 Left 1181238106 22:21460296-21460318 CCAGCGCCGTGAGGTCCTGTTGA No data
Right 1181238119 22:21460344-21460366 CCAGGTAAACCCTCGGACGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181238119 Original CRISPR CCAGGTAAACCCTCGGACGT GGG Intergenic
No off target data available for this crispr