ID: 1181239545

View in Genome Browser
Species Human (GRCh38)
Location 22:21468934-21468956
Sequence TCTGCAGCGCGTCCTGGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181239545_1181239550 -9 Left 1181239545 22:21468934-21468956 CCACACCCAGGACGCGCTGCAGA No data
Right 1181239550 22:21468948-21468970 CGCTGCAGACAGCGGAGGCCTGG No data
1181239545_1181239556 25 Left 1181239545 22:21468934-21468956 CCACACCCAGGACGCGCTGCAGA No data
Right 1181239556 22:21468982-21469004 GGAGCAGACCGTAGTCCTGCAGG No data
1181239545_1181239551 -8 Left 1181239545 22:21468934-21468956 CCACACCCAGGACGCGCTGCAGA No data
Right 1181239551 22:21468949-21468971 GCTGCAGACAGCGGAGGCCTGGG No data
1181239545_1181239552 4 Left 1181239545 22:21468934-21468956 CCACACCCAGGACGCGCTGCAGA No data
Right 1181239552 22:21468961-21468983 GGAGGCCTGGGCCATATTCCAGG No data
1181239545_1181239557 30 Left 1181239545 22:21468934-21468956 CCACACCCAGGACGCGCTGCAGA No data
Right 1181239557 22:21468987-21469009 AGACCGTAGTCCTGCAGGTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181239545 Original CRISPR TCTGCAGCGCGTCCTGGGTG TGG (reversed) Intergenic
No off target data available for this crispr