ID: 1181242812

View in Genome Browser
Species Human (GRCh38)
Location 22:21487118-21487140
Sequence CTGTGGGCAGTGAGGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181242812_1181242825 24 Left 1181242812 22:21487118-21487140 CCCTCCTCCCTCACTGCCCACAG No data
Right 1181242825 22:21487165-21487187 GCTGCACTTGTGGCAGATCAGGG 0: 3
1: 0
2: 0
3: 12
4: 155
1181242812_1181242824 23 Left 1181242812 22:21487118-21487140 CCCTCCTCCCTCACTGCCCACAG No data
Right 1181242824 22:21487164-21487186 AGCTGCACTTGTGGCAGATCAGG 0: 3
1: 0
2: 1
3: 13
4: 125
1181242812_1181242822 14 Left 1181242812 22:21487118-21487140 CCCTCCTCCCTCACTGCCCACAG No data
Right 1181242822 22:21487155-21487177 TTCCACTGAAGCTGCACTTGTGG No data
1181242812_1181242826 29 Left 1181242812 22:21487118-21487140 CCCTCCTCCCTCACTGCCCACAG No data
Right 1181242826 22:21487170-21487192 ACTTGTGGCAGATCAGGGCAAGG 0: 3
1: 0
2: 1
3: 16
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181242812 Original CRISPR CTGTGGGCAGTGAGGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr