ID: 1181243921

View in Genome Browser
Species Human (GRCh38)
Location 22:21492590-21492612
Sequence GGCCATGTGGTCAGGCCAAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181243921_1181243930 8 Left 1181243921 22:21492590-21492612 CCGCTTGGCCTGACCACATGGCC No data
Right 1181243930 22:21492621-21492643 CCAGAGGTTTCACTGCCTAAGGG No data
1181243921_1181243924 -8 Left 1181243921 22:21492590-21492612 CCGCTTGGCCTGACCACATGGCC No data
Right 1181243924 22:21492605-21492627 ACATGGCCTTCCCTCTCCAGAGG No data
1181243921_1181243928 7 Left 1181243921 22:21492590-21492612 CCGCTTGGCCTGACCACATGGCC No data
Right 1181243928 22:21492620-21492642 TCCAGAGGTTTCACTGCCTAAGG No data
1181243921_1181243932 25 Left 1181243921 22:21492590-21492612 CCGCTTGGCCTGACCACATGGCC No data
Right 1181243932 22:21492638-21492660 TAAGGGCTCACCCAAGCTGCAGG No data
1181243921_1181243933 30 Left 1181243921 22:21492590-21492612 CCGCTTGGCCTGACCACATGGCC No data
Right 1181243933 22:21492643-21492665 GCTCACCCAAGCTGCAGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181243921 Original CRISPR GGCCATGTGGTCAGGCCAAG CGG (reversed) Intergenic