ID: 1181243928

View in Genome Browser
Species Human (GRCh38)
Location 22:21492620-21492642
Sequence TCCAGAGGTTTCACTGCCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181243920_1181243928 8 Left 1181243920 22:21492589-21492611 CCCGCTTGGCCTGACCACATGGC No data
Right 1181243928 22:21492620-21492642 TCCAGAGGTTTCACTGCCTAAGG No data
1181243916_1181243928 15 Left 1181243916 22:21492582-21492604 CCCCTAGCCCGCTTGGCCTGACC No data
Right 1181243928 22:21492620-21492642 TCCAGAGGTTTCACTGCCTAAGG No data
1181243918_1181243928 13 Left 1181243918 22:21492584-21492606 CCTAGCCCGCTTGGCCTGACCAC No data
Right 1181243928 22:21492620-21492642 TCCAGAGGTTTCACTGCCTAAGG No data
1181243913_1181243928 21 Left 1181243913 22:21492576-21492598 CCCAGCCCCCTAGCCCGCTTGGC No data
Right 1181243928 22:21492620-21492642 TCCAGAGGTTTCACTGCCTAAGG No data
1181243914_1181243928 20 Left 1181243914 22:21492577-21492599 CCAGCCCCCTAGCCCGCTTGGCC No data
Right 1181243928 22:21492620-21492642 TCCAGAGGTTTCACTGCCTAAGG No data
1181243910_1181243928 30 Left 1181243910 22:21492567-21492589 CCCAGAGGGCCCAGCCCCCTAGC No data
Right 1181243928 22:21492620-21492642 TCCAGAGGTTTCACTGCCTAAGG No data
1181243922_1181243928 -1 Left 1181243922 22:21492598-21492620 CCTGACCACATGGCCTTCCCTCT No data
Right 1181243928 22:21492620-21492642 TCCAGAGGTTTCACTGCCTAAGG No data
1181243917_1181243928 14 Left 1181243917 22:21492583-21492605 CCCTAGCCCGCTTGGCCTGACCA No data
Right 1181243928 22:21492620-21492642 TCCAGAGGTTTCACTGCCTAAGG No data
1181243921_1181243928 7 Left 1181243921 22:21492590-21492612 CCGCTTGGCCTGACCACATGGCC No data
Right 1181243928 22:21492620-21492642 TCCAGAGGTTTCACTGCCTAAGG No data
1181243911_1181243928 29 Left 1181243911 22:21492568-21492590 CCAGAGGGCCCAGCCCCCTAGCC No data
Right 1181243928 22:21492620-21492642 TCCAGAGGTTTCACTGCCTAAGG No data
1181243915_1181243928 16 Left 1181243915 22:21492581-21492603 CCCCCTAGCCCGCTTGGCCTGAC No data
Right 1181243928 22:21492620-21492642 TCCAGAGGTTTCACTGCCTAAGG No data
1181243923_1181243928 -6 Left 1181243923 22:21492603-21492625 CCACATGGCCTTCCCTCTCCAGA No data
Right 1181243928 22:21492620-21492642 TCCAGAGGTTTCACTGCCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181243928 Original CRISPR TCCAGAGGTTTCACTGCCTA AGG Intergenic