ID: 1181243932

View in Genome Browser
Species Human (GRCh38)
Location 22:21492638-21492660
Sequence TAAGGGCTCACCCAAGCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181243929_1181243932 -6 Left 1181243929 22:21492621-21492643 CCAGAGGTTTCACTGCCTAAGGG No data
Right 1181243932 22:21492638-21492660 TAAGGGCTCACCCAAGCTGCAGG No data
1181243923_1181243932 12 Left 1181243923 22:21492603-21492625 CCACATGGCCTTCCCTCTCCAGA No data
Right 1181243932 22:21492638-21492660 TAAGGGCTCACCCAAGCTGCAGG No data
1181243920_1181243932 26 Left 1181243920 22:21492589-21492611 CCCGCTTGGCCTGACCACATGGC No data
Right 1181243932 22:21492638-21492660 TAAGGGCTCACCCAAGCTGCAGG No data
1181243925_1181243932 4 Left 1181243925 22:21492611-21492633 CCTTCCCTCTCCAGAGGTTTCAC No data
Right 1181243932 22:21492638-21492660 TAAGGGCTCACCCAAGCTGCAGG No data
1181243926_1181243932 0 Left 1181243926 22:21492615-21492637 CCCTCTCCAGAGGTTTCACTGCC No data
Right 1181243932 22:21492638-21492660 TAAGGGCTCACCCAAGCTGCAGG No data
1181243921_1181243932 25 Left 1181243921 22:21492590-21492612 CCGCTTGGCCTGACCACATGGCC No data
Right 1181243932 22:21492638-21492660 TAAGGGCTCACCCAAGCTGCAGG No data
1181243927_1181243932 -1 Left 1181243927 22:21492616-21492638 CCTCTCCAGAGGTTTCACTGCCT No data
Right 1181243932 22:21492638-21492660 TAAGGGCTCACCCAAGCTGCAGG No data
1181243922_1181243932 17 Left 1181243922 22:21492598-21492620 CCTGACCACATGGCCTTCCCTCT No data
Right 1181243932 22:21492638-21492660 TAAGGGCTCACCCAAGCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181243932 Original CRISPR TAAGGGCTCACCCAAGCTGC AGG Intergenic