ID: 1181243933

View in Genome Browser
Species Human (GRCh38)
Location 22:21492643-21492665
Sequence GCTCACCCAAGCTGCAGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181243925_1181243933 9 Left 1181243925 22:21492611-21492633 CCTTCCCTCTCCAGAGGTTTCAC No data
Right 1181243933 22:21492643-21492665 GCTCACCCAAGCTGCAGGCCTGG No data
1181243921_1181243933 30 Left 1181243921 22:21492590-21492612 CCGCTTGGCCTGACCACATGGCC No data
Right 1181243933 22:21492643-21492665 GCTCACCCAAGCTGCAGGCCTGG No data
1181243929_1181243933 -1 Left 1181243929 22:21492621-21492643 CCAGAGGTTTCACTGCCTAAGGG No data
Right 1181243933 22:21492643-21492665 GCTCACCCAAGCTGCAGGCCTGG No data
1181243922_1181243933 22 Left 1181243922 22:21492598-21492620 CCTGACCACATGGCCTTCCCTCT No data
Right 1181243933 22:21492643-21492665 GCTCACCCAAGCTGCAGGCCTGG No data
1181243927_1181243933 4 Left 1181243927 22:21492616-21492638 CCTCTCCAGAGGTTTCACTGCCT No data
Right 1181243933 22:21492643-21492665 GCTCACCCAAGCTGCAGGCCTGG No data
1181243923_1181243933 17 Left 1181243923 22:21492603-21492625 CCACATGGCCTTCCCTCTCCAGA No data
Right 1181243933 22:21492643-21492665 GCTCACCCAAGCTGCAGGCCTGG No data
1181243926_1181243933 5 Left 1181243926 22:21492615-21492637 CCCTCTCCAGAGGTTTCACTGCC No data
Right 1181243933 22:21492643-21492665 GCTCACCCAAGCTGCAGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181243933 Original CRISPR GCTCACCCAAGCTGCAGGCC TGG Intergenic