ID: 1181244776

View in Genome Browser
Species Human (GRCh38)
Location 22:21496578-21496600
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 3, 1: 0, 2: 3, 3: 12, 4: 240}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181244765_1181244776 21 Left 1181244765 22:21496534-21496556 CCAGGCATTCAGAACTGCTCCAG 0: 3
1: 0
2: 0
3: 19
4: 181
Right 1181244776 22:21496578-21496600 CCTTCTGGAGGCCATGACTCTGG 0: 3
1: 0
2: 3
3: 12
4: 240
1181244764_1181244776 29 Left 1181244764 22:21496526-21496548 CCAAGAAGCCAGGCATTCAGAAC 0: 3
1: 0
2: 1
3: 27
4: 251
Right 1181244776 22:21496578-21496600 CCTTCTGGAGGCCATGACTCTGG 0: 3
1: 0
2: 3
3: 12
4: 240
1181244769_1181244776 2 Left 1181244769 22:21496553-21496575 CCAGGTGCTGGGCCTCCACATGG 0: 3
1: 1
2: 4
3: 27
4: 242
Right 1181244776 22:21496578-21496600 CCTTCTGGAGGCCATGACTCTGG 0: 3
1: 0
2: 3
3: 12
4: 240
1181244772_1181244776 -10 Left 1181244772 22:21496565-21496587 CCTCCACATGGCTCCTTCTGGAG 0: 3
1: 0
2: 4
3: 26
4: 193
Right 1181244776 22:21496578-21496600 CCTTCTGGAGGCCATGACTCTGG 0: 3
1: 0
2: 3
3: 12
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181244776 Original CRISPR CCTTCTGGAGGCCATGACTC TGG Intergenic
900265006 1:1753081-1753103 CTTTCTGGAAGCCCTGGCTCAGG - Intronic
900942773 1:5811705-5811727 CCTGCTGGAGGCTGTGACGCGGG - Intergenic
903057909 1:20649166-20649188 ACGTCTGGAGGCACTGACTCGGG - Exonic
904371046 1:30047568-30047590 CCTTCAGGAGGCCACAAATCGGG - Intergenic
905738655 1:40350226-40350248 CCTCCTGAAGGCCATGACTCAGG - Intronic
906677097 1:47701140-47701162 GCTCCTGGAGGTCAGGACTCTGG - Intergenic
909595899 1:77405816-77405838 CCTTCTGGAGACCATGTTGCCGG + Intronic
910845085 1:91597334-91597356 CATTCTGCAGCCCATGAATCAGG - Intergenic
912560832 1:110550446-110550468 ACTTCTGGAGGTCAGGAGTCTGG + Intergenic
916120284 1:161523474-161523496 CCAGCTGGAGACCAGGACTCAGG - Intronic
917301304 1:173577201-173577223 CCTGCTGGAGACCATCACTGAGG + Intronic
918508597 1:185285077-185285099 CCTTTTGGAGGCTTTGACTAAGG + Intronic
919785371 1:201255000-201255022 TCTTCTGGAGGTCAGGACTCAGG + Intergenic
920554653 1:206895790-206895812 ACTTCTGGAGGGTAAGACTCGGG + Intergenic
921074047 1:211685643-211685665 CCTTCAGGTCCCCATGACTCAGG - Intergenic
923206039 1:231759837-231759859 TCTTATTGAGGCCATGACTAAGG - Intronic
924947705 1:248857473-248857495 CCTTTTGGAGGCAAAGGCTCAGG + Exonic
1065750318 10:28879962-28879984 CCTTCTGGAGTCCATGTCTCTGG + Intronic
1066283127 10:33937735-33937757 CCTCCTGTGGGCCATGACCCTGG + Intergenic
1067511099 10:46895700-46895722 TCTTCTGGAGGCAAAGACTCTGG - Intergenic
1067651154 10:48156162-48156184 TCTTCTGGAGGCAAAGACTCTGG + Intergenic
1068439716 10:57035988-57036010 CCTTCTGAAGGACATGCCTGAGG + Intergenic
1069580199 10:69560381-69560403 CCTGCTGGAGGCCAGGACCAAGG - Intergenic
1070189319 10:74097218-74097240 GATGCAGGAGGCCATGACTCAGG + Exonic
1070932861 10:80273320-80273342 CTTTCTGGAGACCCTGGCTCAGG + Exonic
1070978753 10:80627673-80627695 CCTTCTAGAAGCTCTGACTCTGG - Intronic
1071137166 10:82466262-82466284 GCTTCTAGAGTTCATGACTCTGG - Intronic
1072863756 10:99035456-99035478 CCTTCTGGAGGACCTGCCTGAGG + Intronic
1073042448 10:100616895-100616917 CCTTCTGGAGGTGATGATGCAGG - Intergenic
1074442455 10:113490463-113490485 CAGTCTGGAGGACATGACTGTGG + Intergenic
1074853261 10:117455556-117455578 CCGTGGGGAGGCCAGGACTCAGG - Intergenic
1076188656 10:128467872-128467894 CCTTGTGGAGGCCAGAATTCCGG + Intergenic
1076229341 10:128807364-128807386 GCTTCAGGAGCCCCTGACTCTGG - Intergenic
1077009463 11:373746-373768 CCTCCGGGAGGCCATGAGCCTGG - Exonic
1078713303 11:13815997-13816019 CCTACTCAAGGACATGACTCAGG - Intergenic
1081978840 11:47253783-47253805 CCTGCAGGAGGCAATGTCTCTGG - Intronic
1083280324 11:61622835-61622857 TTTTCTGGACCCCATGACTCAGG - Intergenic
1085300649 11:75456370-75456392 CCCTCTGGGGGCCCTGCCTCGGG - Intronic
1085404019 11:76251063-76251085 CCTTCTGGAAGCCCAGACTTTGG + Intergenic
1086495030 11:87394423-87394445 CATTCTGTAGCCCATGAATCAGG + Intergenic
1087806249 11:102558632-102558654 CCTTCTGGAGCCCAGACCTCAGG + Intergenic
1088493937 11:110414459-110414481 CCTTCTGAAGGACCTGACTGAGG - Intergenic
1088807217 11:113363567-113363589 CCTTCCGGAGGCAATTACTCAGG + Intronic
1089331615 11:117692862-117692884 CCCTCTGGAGCCCATGAAACTGG + Intronic
1090521757 11:127487227-127487249 CCTTCTGGAGGCAGAGAGTCAGG - Intergenic
1090869400 11:130729545-130729567 CCTTCTGGAGGCCATTTCTTGGG - Intergenic
1092441626 12:8509563-8509585 CCTGGTGGAGGACAGGACTCGGG + Intronic
1096552273 12:52380816-52380838 CCCTCTAGATGCCATGACTCTGG - Intronic
1096711934 12:53464097-53464119 CCTTCTGGCGACACTGACTCTGG - Intronic
1097885513 12:64724899-64724921 CCTTCTGGCTTCCATGGCTCAGG - Intronic
1098017136 12:66117647-66117669 CCTTCTGGAGGACCTGCCTGAGG - Exonic
1100079097 12:90825881-90825903 GCTTATGGAGGCCATCATTCTGG - Intergenic
1102012624 12:109627984-109628006 GATTCCAGAGGCCATGACTCAGG - Intergenic
1103462990 12:121119907-121119929 CCTCCTGGAGTCCAGGACTAGGG + Intergenic
1104457586 12:128928292-128928314 CGTTCTGGTGGCCGTGACTATGG + Intronic
1104644648 12:130488219-130488241 TCTCCTGGAGGCCATCACACTGG + Intronic
1105323393 13:19347964-19347986 CCTTCTGGTGGCCAACACCCTGG + Intergenic
1105873995 13:24537873-24537895 CCTTCTGGTGGCCAACACCCTGG - Intergenic
1107217048 13:37934292-37934314 CCATCTGGAGACCAGGACACTGG + Intergenic
1107460506 13:40597532-40597554 CCTTGTTGAAGCCATGACTAAGG - Intronic
1107518089 13:41151326-41151348 CATTCTTGAAGACATGACTCAGG - Intergenic
1108909190 13:55521466-55521488 CATTCTGTAGCCCATGAATCAGG - Intergenic
1113628496 13:111864048-111864070 CCTCCTGTGGGCCCTGACTCAGG - Intergenic
1113833313 13:113313677-113313699 CCTCCAGGAGGCCATGCCCCAGG - Intronic
1113833338 13:113313773-113313795 CCTCCAGGAGGCCATGCCCCAGG - Intronic
1113833363 13:113313869-113313891 CCTCCAGGAGGCCATGCCCCAGG - Intronic
1113833646 13:113314925-113314947 CCTCCAGGAGGCCATGCCCCAGG - Intronic
1116050879 14:39801681-39801703 CCTCCAGGAGACCATGACACAGG - Intergenic
1116369236 14:44108870-44108892 CCTTCTGCTGGCAATGAGTCTGG + Intergenic
1118589789 14:67392781-67392803 CCGTCTGGAGGCGGTGACCCTGG - Exonic
1120592380 14:86391069-86391091 CCTTCTGGAGCCCAGAACTTGGG + Intergenic
1121011016 14:90520418-90520440 CCTGCTGGAGCCCAGGAGTCTGG - Intergenic
1121504839 14:94469234-94469256 CCTTCTGACGGCCATGGTTCTGG - Exonic
1121556859 14:94844719-94844741 CCTTCTGGACTCCATCAGTCGGG - Intergenic
1121760044 14:96436965-96436987 TCTGCTGGAGGCCATGCCTTAGG - Intronic
1121974310 14:98388708-98388730 CCTTATGGGGGCCATGAAGCTGG - Intergenic
1122094890 14:99363540-99363562 GATTCTGGAGCCAATGACTCTGG + Intergenic
1122207353 14:100154629-100154651 CCTTCAGCAGGCCCTGCCTCTGG - Intronic
1125322607 15:38504592-38504614 CCTTCTGGAGGACTTGCCTGAGG + Intronic
1126220878 15:46211340-46211362 CCATCTGGAGACCATCATTCTGG + Intergenic
1126420832 15:48470290-48470312 CGTTTTGGAGGCCATGCCCCGGG - Intronic
1128348724 15:66874591-66874613 CCTGCTGGAGGCTCTGAGTCTGG + Intergenic
1128502083 15:68233680-68233702 CCTTCTGGAGTCCCAGCCTCTGG - Intronic
1128820323 15:70646487-70646509 ACTTCTGGAGGCCAAAAGTCAGG - Intergenic
1129185145 15:73901556-73901578 AGTTCTGGAGGCCAGGAGTCTGG + Intergenic
1129189575 15:73929468-73929490 ACTGCTGGAGGCCAAGACTAGGG + Intronic
1129720097 15:77873195-77873217 CCTTCTGCAGGTCACGTCTCTGG + Intergenic
1129974219 15:79807914-79807936 TCTTTTGGAGGCCATTATTCTGG + Intergenic
1130058332 15:80549702-80549724 CATTCTGTTGGCCAAGACTCTGG + Intronic
1130931641 15:88432609-88432631 CCTTTTGCTGGCCAAGACTCAGG + Intergenic
1130990747 15:88874296-88874318 CCTTGTGGAAACCAGGACTCAGG - Intronic
1131278064 15:90998986-90999008 CCTTATGGAGGCCATGAGTGAGG - Exonic
1131696475 15:94882410-94882432 CCTTCTGGAGGCCCAGACCTCGG - Intergenic
1132196260 15:99916716-99916738 CCTCCTGGGGGCCCTGACTGGGG - Intergenic
1132369556 15:101284883-101284905 CCATTTAGATGCCATGACTCTGG - Intronic
1132558789 16:584239-584261 CCTGCTGGAGGCCCTGACGACGG + Intergenic
1133312700 16:4860563-4860585 TCTCCTGGAGACCATGACCCTGG + Intronic
1138646790 16:58431493-58431515 CCTTCTGCAAGCTCTGACTCAGG - Intergenic
1138992603 16:62409643-62409665 CCTTCTGGAGGCCCAGACCTTGG - Intergenic
1140781851 16:78304111-78304133 CTTTGGGGAGGTCATGACTCAGG - Intronic
1143355034 17:6321333-6321355 CGTTCTTCAGGCCATAACTCAGG - Intergenic
1143862242 17:9899379-9899401 CCATCTGGAGACAATGCCTCAGG - Intronic
1145416420 17:22717138-22717160 CTTTCTAGAGGCGGTGACTCAGG - Intergenic
1147658598 17:42105098-42105120 CCTTCTGGTGGCCACGAGTGTGG - Exonic
1148889743 17:50799146-50799168 GGTTCTGGAGGCCAGGAGTCTGG + Intergenic
1150815328 17:68388169-68388191 CCTTCAGGAGGCCAGGGCTTTGG + Intronic
1151186637 17:72369600-72369622 CCTTCTGGACGCCAGGGCTCCGG - Intergenic
1152627898 17:81396619-81396641 CCTGCCGGAGACCAGGACTCTGG - Intronic
1153170628 18:2312017-2312039 CCTTCTTGACTCCATGACTGTGG - Intergenic
1153584950 18:6611680-6611702 CCTTCTGGAAGCCTGGGCTCTGG - Intergenic
1153685924 18:7545338-7545360 ATTTCTGGAGGCCAGGAGTCTGG + Intergenic
1158164858 18:54528957-54528979 ACTTCTTGAGGCCATGTCACAGG - Intergenic
1158192117 18:54841815-54841837 ATTTCTGAAGGCAATGACTCAGG - Intronic
1160682635 19:418805-418827 CCCTCTAGAGGGCACGACTCAGG - Intronic
1160722986 19:605349-605371 CCTTATGGAGGGGAGGACTCGGG + Intronic
1160723006 19:605401-605423 CCTTATGGAGGGGAGGACTCGGG + Intronic
1160723026 19:605453-605475 CCTTATGGAGGGGAGGACTCGGG + Intronic
1160723046 19:605505-605527 CCTTATGGAGGGGAGGACTCGGG + Intronic
1160723066 19:605557-605579 CCTTATGGAGGGGAGGACTCGGG + Intronic
1160723086 19:605609-605631 CCTTATGGAGGGGAGGACTCGGG + Intronic
1160723106 19:605661-605683 CCTTATGGAGGGGAGGACTCGGG + Intronic
1160723126 19:605713-605735 CCTTATGGAGGGGAGGACTCGGG + Intronic
1160723145 19:605765-605787 CCTTATGGAGGGAAGGACTCGGG + Intronic
1162938889 19:13996321-13996343 CCTGCAGCTGGCCATGACTCCGG + Intronic
1163190119 19:15671197-15671219 TCCTCTGGATGCCATCACTCAGG + Intergenic
1163291824 19:16384048-16384070 CCTCCTGGAGCCCATGGCCCAGG - Intronic
1165131685 19:33636463-33636485 GCTTCTGGAGACAAAGACTCAGG - Intronic
1165132451 19:33641341-33641363 CCTTCTTGAGGTCAGGACTGGGG + Intronic
1165178828 19:33950151-33950173 GCTTCTGGAAGCCAGGCCTCTGG - Intergenic
1168630134 19:57949957-57949979 TCTTCTGGAGGCCCAGACTTTGG - Intergenic
925753141 2:7107984-7108006 CCTGCTGCAGGCCATGATGCAGG + Intergenic
927874764 2:26648014-26648036 CCGTCTGGAGACCCTCACTCAGG - Intergenic
931666810 2:64615674-64615696 CATTCTGGAGTCCGTGGCTCTGG - Intergenic
932661391 2:73656107-73656129 ACTTCTGGAGACCAAGACTGGGG - Intergenic
933376107 2:81481802-81481824 CCTTCTGGAAGGCAAGACCCTGG - Intergenic
935352062 2:102159555-102159577 CCCTCTGGAGGTTATGGCTCTGG + Intronic
938942250 2:136179512-136179534 CCTGCTGCAGGCCTGGACTCGGG - Intergenic
942335368 2:174879041-174879063 CCTTCAGGAGACCATTACACTGG - Intronic
942667574 2:178336597-178336619 CCTTCTCTCTGCCATGACTCAGG + Intronic
943341798 2:186691331-186691353 CCTTCTGGAGGCAAAGCCACTGG - Intergenic
944075353 2:195723525-195723547 CCTGGTGGAGTCCAAGACTCTGG - Intronic
945408155 2:209476166-209476188 CCTTCTCGAGACCATGATTGTGG + Intronic
945741156 2:213663234-213663256 CCTTCTGTACACCATGACTATGG + Intronic
946099816 2:217310408-217310430 CACTCTGGAAGCCATGAATCTGG + Intronic
946253777 2:218429275-218429297 CTTCCTGCAGGGCATGACTCTGG + Exonic
946850487 2:223901548-223901570 GCTTCTGGTGGCCATGCCTGTGG - Intronic
947742636 2:232491560-232491582 CCTTCTGGAGCCCAGGACAGGGG + Intergenic
948051913 2:234984995-234985017 CTTTCTGGAGGCCAGGAGGCGGG + Intronic
948453366 2:238092537-238092559 CCATCTGGCAGCCAGGACTCAGG - Intronic
948770999 2:240251203-240251225 CCTGCAGGAGGCCACGCCTCTGG + Intergenic
1171519728 20:25766531-25766553 CTTTCTAGAGGCAGTGACTCAGG - Intronic
1171557192 20:26089962-26089984 CTTTCTAGAGGCAGTGACTCAGG + Intergenic
1173740162 20:45394724-45394746 CCTTCTGGAGGCCCAGACCTCGG + Intronic
1175371842 20:58497432-58497454 CCTGCTGGAGGCCATGAGTCTGG + Intronic
1175841332 20:62029575-62029597 GCTCCTGGAGGCCAGGAGTCAGG - Intronic
1176375009 21:6082719-6082741 ACCTCTGGGGGTCATGACTCGGG - Intergenic
1176653869 21:9572815-9572837 CTTTCTAGAGGCAGTGACTCAGG - Intergenic
1176861519 21:14013823-14013845 CTTTCTCGAGGCCTTGGCTCTGG - Intergenic
1179345353 21:40551122-40551144 ACTTCTTGAGGCTATGCCTCAGG - Intronic
1179748466 21:43455526-43455548 ACCTCTGGGGGTCATGACTCGGG + Intergenic
1180787865 22:18557053-18557075 CCTTCTGGAGGCCATGACTCTGG + Intergenic
1181015387 22:20065784-20065806 CCAGCTGGAGACCATGCCTCTGG + Exonic
1181233871 22:21438253-21438275 CCTTCTGGAGGCCATGACTCTGG - Intronic
1181244776 22:21496578-21496600 CCTTCTGGAGGCCATGACTCTGG + Intergenic
1181471154 22:23140911-23140933 CTTACTGGAGGCCATGAAACTGG + Intronic
1181731507 22:24850286-24850308 TCTCCTGGAGGCCTTGAATCTGG - Exonic
1183967912 22:41454136-41454158 ACTTTGGGAGGCCATGGCTCAGG + Intergenic
1184703729 22:46195937-46195959 CCTTCTAGAGGCTCTGCCTCGGG - Intronic
1185002650 22:48255559-48255581 GCTTCTGGACACCATCACTCAGG - Intergenic
1185045584 22:48527163-48527185 CCCTCTGGAGGCTGTGGCTCTGG + Intronic
952363270 3:32652228-32652250 CCTCCTGGAGGACCTGCCTCAGG - Intergenic
952964851 3:38614784-38614806 GCTTCTGGAGGCCACTCCTCCGG - Intronic
953664134 3:44913967-44913989 GATTTTTGAGGCCATGACTCAGG - Exonic
953871013 3:46627649-46627671 CCTTCTGCACCCCATCACTCAGG - Intergenic
953933533 3:47019962-47019984 CCGTTTAGAGGCCCTGACTCAGG + Intronic
954633827 3:52060925-52060947 CCCTCTGGAGGACATGTCTGTGG - Intergenic
956797201 3:72727910-72727932 CCTTCAGGAGGGCATTACTCTGG + Intergenic
957820732 3:85370732-85370754 CCTCCTGAAGGCCCTGCCTCAGG - Intronic
959628394 3:108480170-108480192 CCTTCTGGACTGCATGACTGGGG + Intronic
966679789 3:182629733-182629755 CCCCCTGGAGGAAATGACTCAGG + Intergenic
967322045 3:188204280-188204302 CATCCTGGAGGCCTTGAGTCTGG + Intronic
968327392 3:197830795-197830817 CCTTATGGAGCCCTTGATTCAGG + Exonic
969231488 4:5834915-5834937 GCTTCTGCAGGCCATGTCTGTGG + Intronic
970648278 4:18147919-18147941 CCTTCTGGAGGACGGGTCTCAGG + Intergenic
972133235 4:35862221-35862243 CTGTCTGAAGGCCATGACTAAGG + Intergenic
972147340 4:36044010-36044032 GCTTCTGGATGACATAACTCAGG + Intronic
975627220 4:76361837-76361859 CCTTTTGGAAGCCTGGACTCTGG + Intronic
978218474 4:106238911-106238933 ACTTCTGGAGGCCCTGCCTTAGG + Intronic
979744450 4:124193844-124193866 CATTCTGTAGCCCATGAATCAGG - Intergenic
985570864 5:644008-644030 CCTGCTGGAGCACATGCCTCAGG + Intronic
986399861 5:7370272-7370294 GCTTCTGGAGCTCATCACTCCGG - Intergenic
988681553 5:33488952-33488974 CCTTCTGGGGGCCTAGACTTTGG - Intergenic
989225218 5:39019723-39019745 CATTCTGCAGCCCATGAATCGGG + Intronic
989654031 5:43724844-43724866 CATTCTGCAGCCCATGAGTCAGG - Intergenic
994635892 5:102343954-102343976 CCTTATTTAGGCCAAGACTCAGG + Intergenic
995228084 5:109725640-109725662 CCTTCTAGAGTCCAGGGCTCAGG + Intronic
995566225 5:113434964-113434986 CCTCCTAGAGGCCAAGACTCTGG + Exonic
995826016 5:116300342-116300364 CCTTCTGGAGGGCAGAAATCTGG - Intronic
996176814 5:120369010-120369032 CCTTCTGGGGGCCCAGACTTTGG + Intergenic
997758664 5:136423825-136423847 CCTGGTGGAGGCGATGAGTCAGG + Intergenic
999189623 5:149737401-149737423 CCTCCTGGAGGCTTAGACTCAGG + Intronic
1001546460 5:172573598-172573620 CCTCCAGGAGGCCAAGACTGAGG + Intergenic
1002947805 6:1779472-1779494 GCTTCTAGAGACAATGACTCTGG + Intronic
1004519327 6:16347068-16347090 CCTTCTGGCGGGCAGGGCTCGGG + Intronic
1005195730 6:23281766-23281788 CCTTCTGGATGCCATTCCTGGGG + Intergenic
1006896176 6:37472561-37472583 CCCTCTGGAGACCATGCATCTGG - Intronic
1007071632 6:39042347-39042369 CGTTCTGGAGGCCAGAAGTCTGG - Intergenic
1007174260 6:39885457-39885479 CTTTCTGCAGGACAGGACTCTGG + Intronic
1011388337 6:86822059-86822081 CCTTCTGAAGGGCTTCACTCTGG + Intergenic
1015669623 6:135673627-135673649 CCATCTGGGTGCGATGACTCTGG - Intergenic
1016397420 6:143640311-143640333 CCTTCTGGAGGAACTGACTGAGG - Intronic
1018251082 6:161871267-161871289 ACTTTTGGGGGCCATGTCTCTGG - Intronic
1018505485 6:164463334-164463356 CCTTCTGGAGAACATGGCCCCGG + Intergenic
1018871631 6:167788342-167788364 GCTTCGGGAGGCTCTGACTCAGG - Intronic
1018894162 6:168001808-168001830 CCTGCCCGAGGCCATGCCTCAGG - Intronic
1018894208 6:168002043-168002065 CCTGCCCGAGGCCATGCCTCAGG - Intronic
1018894250 6:168002245-168002267 CCTGCCCGAGGCCATGCCTCAGG - Intronic
1018900000 6:168046312-168046334 CCTTCTGCCCGCCATGAGTCAGG - Intergenic
1020805735 7:12788299-12788321 ACTTCTGAAGGCCTTGCCTCAGG - Intergenic
1022096514 7:27144841-27144863 ACGTCTGGAAGCCAGGACTCTGG + Intronic
1023116012 7:36863242-36863264 TCTTCTTTAGGCCCTGACTCAGG + Intronic
1024030180 7:45454228-45454250 CCTTGTGGGGGCCATGCCACAGG - Intergenic
1024730518 7:52248705-52248727 TCTTCTGGAGGACATGTCACTGG + Intergenic
1024747198 7:52421657-52421679 TCTTTTGGTGGCCATAACTCTGG - Intergenic
1025280216 7:57621481-57621503 CTTTGTAGAGGCAATGACTCAGG - Intergenic
1025304517 7:57844020-57844042 CTTTGTAGAGGCAATGACTCAGG + Intergenic
1026229616 7:68471579-68471601 CCATCTGGTAGCCAGGACTCAGG - Intergenic
1029095068 7:98078534-98078556 CCTCCTCGACGCCATGGCTCAGG + Intergenic
1029205743 7:98868588-98868610 CTTTCTGGAGTCCATGAATCAGG - Intronic
1031281684 7:119810657-119810679 CATTCTGCAGCCCATGAATCAGG - Intergenic
1033885304 7:145937000-145937022 GTTTCTGGAGGCCAGGATTCTGG - Intergenic
1034725528 7:153331999-153332021 CCTCCTGGACCCCATGACACTGG + Intergenic
1037167935 8:15853692-15853714 CCTGCTGGAGTCCTTGCCTCAGG + Intergenic
1037819454 8:22128714-22128736 CCTTCTGGAGACCAAGATCCTGG - Exonic
1038403584 8:27305358-27305380 ACTGCTGGAGGCCATCACTCAGG + Intronic
1046994013 8:120495370-120495392 CCTTCTAGAGACAATGATTCTGG - Intronic
1048085014 8:131167891-131167913 CCTTCTGAGGGCCGTGACTGAGG - Intergenic
1048736699 8:137510109-137510131 CCTTCTGGACTCCATGGCTTGGG + Intergenic
1048855886 8:138686319-138686341 CCTTGTGGCGGCCCTGACTGTGG + Intronic
1052437204 9:28444282-28444304 CCTTCTGGTGGCCCAGACTTTGG + Intronic
1056116394 9:83445420-83445442 TCTTCTGGATGGCATGCCTCTGG - Intronic
1057001982 9:91518580-91518602 CCTTCTGCAGGCCATTCCGCTGG - Intergenic
1059786446 9:117591409-117591431 CCTTCTCAGGGCCCTGACTCTGG + Intergenic
1060534388 9:124372498-124372520 CCTTCTTGGGGCCAGGTCTCTGG - Intronic
1061052745 9:128205776-128205798 CTTCCTGGAGCCCATGACGCAGG + Intronic
1061548741 9:131320177-131320199 CCTCCTGGAGGCCAGGCCCCAGG - Intergenic
1062707107 9:137951864-137951886 CCTTCAGGAGGACATGGCTTTGG + Intronic
1203781416 EBV:103067-103089 CCTTCTCTAGGCCATTAATCTGG - Intergenic
1203631590 Un_KI270750v1:76267-76289 CTTTCTAGAGGCAGTGACTCAGG - Intergenic
1186664595 X:11704557-11704579 CATTCTGGAGGCAATGCCTTTGG + Intergenic
1186876811 X:13825545-13825567 CCTTCTGGTTGCCTTGACTGTGG - Intronic
1188903443 X:35762595-35762617 CCTCCTGCAGGCCAGGACACTGG + Intergenic
1192904605 X:75537700-75537722 GCTTCTGGAGGCATTGCCTCAGG + Intergenic
1196606146 X:117659521-117659543 CCTTCTGAAGGACATGCCTGAGG - Intergenic
1196830314 X:119770846-119770868 CTTTCTGGAAGCAATTACTCTGG - Intergenic
1197836196 X:130696325-130696347 ACCTTTGGAGGGCATGACTCTGG - Intronic
1198032745 X:132769392-132769414 CCTTCTGGAGCCCATGCATTGGG - Intronic
1201318317 Y:12669821-12669843 TCTTCAGGAGACCATGAATCTGG + Intergenic