ID: 1181248420

View in Genome Browser
Species Human (GRCh38)
Location 22:21517316-21517338
Sequence GCCCCTCACCTCGTGTGCGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 18 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181248400_1181248420 20 Left 1181248400 22:21517273-21517295 CCCGGCCCCCGCCCGCTCCCCGC No data
Right 1181248420 22:21517316-21517338 GCCCCTCACCTCGTGTGCGTCGG No data
1181248398_1181248420 27 Left 1181248398 22:21517266-21517288 CCGCGGCCCCGGCCCCCGCCCGC No data
Right 1181248420 22:21517316-21517338 GCCCCTCACCTCGTGTGCGTCGG No data
1181248413_1181248420 -6 Left 1181248413 22:21517299-21517321 CCCCGCCCCACAAGGCCGCCCCT No data
Right 1181248420 22:21517316-21517338 GCCCCTCACCTCGTGTGCGTCGG No data
1181248404_1181248420 13 Left 1181248404 22:21517280-21517302 CCCGCCCGCTCCCCGCGACCCCC No data
Right 1181248420 22:21517316-21517338 GCCCCTCACCTCGTGTGCGTCGG No data
1181248414_1181248420 -7 Left 1181248414 22:21517300-21517322 CCCGCCCCACAAGGCCGCCCCTC No data
Right 1181248420 22:21517316-21517338 GCCCCTCACCTCGTGTGCGTCGG No data
1181248405_1181248420 12 Left 1181248405 22:21517281-21517303 CCGCCCGCTCCCCGCGACCCCCG No data
Right 1181248420 22:21517316-21517338 GCCCCTCACCTCGTGTGCGTCGG No data
1181248415_1181248420 -8 Left 1181248415 22:21517301-21517323 CCGCCCCACAAGGCCGCCCCTCA No data
Right 1181248420 22:21517316-21517338 GCCCCTCACCTCGTGTGCGTCGG No data
1181248399_1181248420 21 Left 1181248399 22:21517272-21517294 CCCCGGCCCCCGCCCGCTCCCCG No data
Right 1181248420 22:21517316-21517338 GCCCCTCACCTCGTGTGCGTCGG No data
1181248407_1181248420 8 Left 1181248407 22:21517285-21517307 CCGCTCCCCGCGACCCCCGCCCC No data
Right 1181248420 22:21517316-21517338 GCCCCTCACCTCGTGTGCGTCGG No data
1181248401_1181248420 19 Left 1181248401 22:21517274-21517296 CCGGCCCCCGCCCGCTCCCCGCG No data
Right 1181248420 22:21517316-21517338 GCCCCTCACCTCGTGTGCGTCGG No data
1181248412_1181248420 -5 Left 1181248412 22:21517298-21517320 CCCCCGCCCCACAAGGCCGCCCC No data
Right 1181248420 22:21517316-21517338 GCCCCTCACCTCGTGTGCGTCGG No data
1181248403_1181248420 14 Left 1181248403 22:21517279-21517301 CCCCGCCCGCTCCCCGCGACCCC No data
Right 1181248420 22:21517316-21517338 GCCCCTCACCTCGTGTGCGTCGG No data
1181248409_1181248420 2 Left 1181248409 22:21517291-21517313 CCCGCGACCCCCGCCCCACAAGG No data
Right 1181248420 22:21517316-21517338 GCCCCTCACCTCGTGTGCGTCGG No data
1181248397_1181248420 28 Left 1181248397 22:21517265-21517287 CCCGCGGCCCCGGCCCCCGCCCG No data
Right 1181248420 22:21517316-21517338 GCCCCTCACCTCGTGTGCGTCGG No data
1181248402_1181248420 15 Left 1181248402 22:21517278-21517300 CCCCCGCCCGCTCCCCGCGACCC No data
Right 1181248420 22:21517316-21517338 GCCCCTCACCTCGTGTGCGTCGG No data
1181248406_1181248420 9 Left 1181248406 22:21517284-21517306 CCCGCTCCCCGCGACCCCCGCCC No data
Right 1181248420 22:21517316-21517338 GCCCCTCACCTCGTGTGCGTCGG No data
1181248411_1181248420 1 Left 1181248411 22:21517292-21517314 CCGCGACCCCCGCCCCACAAGGC No data
Right 1181248420 22:21517316-21517338 GCCCCTCACCTCGTGTGCGTCGG No data
1181248408_1181248420 3 Left 1181248408 22:21517290-21517312 CCCCGCGACCCCCGCCCCACAAG No data
Right 1181248420 22:21517316-21517338 GCCCCTCACCTCGTGTGCGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181248420 Original CRISPR GCCCCTCACCTCGTGTGCGT CGG Intergenic