ID: 1181250344

View in Genome Browser
Species Human (GRCh38)
Location 22:21529537-21529559
Sequence GTCTCCACCATTAGACTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181250340_1181250344 15 Left 1181250340 22:21529499-21529521 CCTGATCAATCTGCCACGTGCCA No data
Right 1181250344 22:21529537-21529559 GTCTCCACCATTAGACTGGCAGG No data
1181250339_1181250344 21 Left 1181250339 22:21529493-21529515 CCTGCTCCTGATCAATCTGCCAC No data
Right 1181250344 22:21529537-21529559 GTCTCCACCATTAGACTGGCAGG No data
1181250342_1181250344 -5 Left 1181250342 22:21529519-21529541 CCATTTGATCTCAGAGTTGTCTC No data
Right 1181250344 22:21529537-21529559 GTCTCCACCATTAGACTGGCAGG No data
1181250341_1181250344 2 Left 1181250341 22:21529512-21529534 CCACGTGCCATTTGATCTCAGAG No data
Right 1181250344 22:21529537-21529559 GTCTCCACCATTAGACTGGCAGG No data
1181250338_1181250344 30 Left 1181250338 22:21529484-21529506 CCTGGGTCTCCTGCTCCTGATCA No data
Right 1181250344 22:21529537-21529559 GTCTCCACCATTAGACTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181250344 Original CRISPR GTCTCCACCATTAGACTGGC AGG Intergenic
No off target data available for this crispr