ID: 1181250665

View in Genome Browser
Species Human (GRCh38)
Location 22:21531423-21531445
Sequence GAGGCTGTTGCCCCAGCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181250665_1181250669 -5 Left 1181250665 22:21531423-21531445 CCCTGAGCTGGGGCAACAGCCTC No data
Right 1181250669 22:21531441-21531463 GCCTCTGGTCACAGTCATGAGGG No data
1181250665_1181250672 2 Left 1181250665 22:21531423-21531445 CCCTGAGCTGGGGCAACAGCCTC No data
Right 1181250672 22:21531448-21531470 GTCACAGTCATGAGGGAGGCTGG No data
1181250665_1181250671 -2 Left 1181250665 22:21531423-21531445 CCCTGAGCTGGGGCAACAGCCTC No data
Right 1181250671 22:21531444-21531466 TCTGGTCACAGTCATGAGGGAGG No data
1181250665_1181250668 -6 Left 1181250665 22:21531423-21531445 CCCTGAGCTGGGGCAACAGCCTC No data
Right 1181250668 22:21531440-21531462 AGCCTCTGGTCACAGTCATGAGG No data
1181250665_1181250673 3 Left 1181250665 22:21531423-21531445 CCCTGAGCTGGGGCAACAGCCTC No data
Right 1181250673 22:21531449-21531471 TCACAGTCATGAGGGAGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181250665 Original CRISPR GAGGCTGTTGCCCCAGCTCA GGG (reversed) Intergenic
No off target data available for this crispr