ID: 1181252109

View in Genome Browser
Species Human (GRCh38)
Location 22:21539883-21539905
Sequence CTTTGGAAGGCCAAGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 274879
Summary {0: 52, 1: 2206, 2: 28156, 3: 83347, 4: 161118}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181252109_1181252114 -8 Left 1181252109 22:21539883-21539905 CCATCCACCTTGGCCTTCCAAAG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118
Right 1181252114 22:21539898-21539920 TTCCAAAGTGCTGGAACTACAGG No data
1181252109_1181252116 10 Left 1181252109 22:21539883-21539905 CCATCCACCTTGGCCTTCCAAAG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118
Right 1181252116 22:21539916-21539938 ACAGGCTTGTGCCACCACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181252109 Original CRISPR CTTTGGAAGGCCAAGGTGGA TGG (reversed) Intergenic
Too many off-targets to display for this crispr