ID: 1181252114

View in Genome Browser
Species Human (GRCh38)
Location 22:21539898-21539920
Sequence TTCCAAAGTGCTGGAACTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181252103_1181252114 27 Left 1181252103 22:21539848-21539870 CCCATGCTGGTCTCCAACTCCTT No data
Right 1181252114 22:21539898-21539920 TTCCAAAGTGCTGGAACTACAGG No data
1181252104_1181252114 26 Left 1181252104 22:21539849-21539871 CCATGCTGGTCTCCAACTCCTTG No data
Right 1181252114 22:21539898-21539920 TTCCAAAGTGCTGGAACTACAGG No data
1181252106_1181252114 14 Left 1181252106 22:21539861-21539883 CCAACTCCTTGGCTCAAGCGATC No data
Right 1181252114 22:21539898-21539920 TTCCAAAGTGCTGGAACTACAGG No data
1181252107_1181252114 8 Left 1181252107 22:21539867-21539889 CCTTGGCTCAAGCGATCCATCCA No data
Right 1181252114 22:21539898-21539920 TTCCAAAGTGCTGGAACTACAGG No data
1181252109_1181252114 -8 Left 1181252109 22:21539883-21539905 CCATCCACCTTGGCCTTCCAAAG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118
Right 1181252114 22:21539898-21539920 TTCCAAAGTGCTGGAACTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181252114 Original CRISPR TTCCAAAGTGCTGGAACTAC AGG Intergenic
No off target data available for this crispr