ID: 1181252116

View in Genome Browser
Species Human (GRCh38)
Location 22:21539916-21539938
Sequence ACAGGCTTGTGCCACCACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181252109_1181252116 10 Left 1181252109 22:21539883-21539905 CCATCCACCTTGGCCTTCCAAAG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118
Right 1181252116 22:21539916-21539938 ACAGGCTTGTGCCACCACCCTGG No data
1181252110_1181252116 6 Left 1181252110 22:21539887-21539909 CCACCTTGGCCTTCCAAAGTGCT 0: 1988
1: 60767
2: 149928
3: 159035
4: 96689
Right 1181252116 22:21539916-21539938 ACAGGCTTGTGCCACCACCCTGG No data
1181252107_1181252116 26 Left 1181252107 22:21539867-21539889 CCTTGGCTCAAGCGATCCATCCA No data
Right 1181252116 22:21539916-21539938 ACAGGCTTGTGCCACCACCCTGG No data
1181252113_1181252116 -3 Left 1181252113 22:21539896-21539918 CCTTCCAAAGTGCTGGAACTACA 0: 12
1: 829
2: 26482
3: 326403
4: 267184
Right 1181252116 22:21539916-21539938 ACAGGCTTGTGCCACCACCCTGG No data
1181252112_1181252116 3 Left 1181252112 22:21539890-21539912 CCTTGGCCTTCCAAAGTGCTGGA 0: 196
1: 7594
2: 98671
3: 219009
4: 234301
Right 1181252116 22:21539916-21539938 ACAGGCTTGTGCCACCACCCTGG No data
1181252115_1181252116 -7 Left 1181252115 22:21539900-21539922 CCAAAGTGCTGGAACTACAGGCT 0: 11
1: 518
2: 18713
3: 245018
4: 286230
Right 1181252116 22:21539916-21539938 ACAGGCTTGTGCCACCACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181252116 Original CRISPR ACAGGCTTGTGCCACCACCC TGG Intergenic
No off target data available for this crispr