ID: 1181252799

View in Genome Browser
Species Human (GRCh38)
Location 22:21544685-21544707
Sequence TTCCCCGAGGGCATCCCCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181252799_1181252803 -8 Left 1181252799 22:21544685-21544707 CCTGCGGGGATGCCCTCGGGGAA No data
Right 1181252803 22:21544700-21544722 TCGGGGAAGATGTGGCCCAGAGG No data
1181252799_1181252805 3 Left 1181252799 22:21544685-21544707 CCTGCGGGGATGCCCTCGGGGAA No data
Right 1181252805 22:21544711-21544733 GTGGCCCAGAGGAGTTTTTTGGG No data
1181252799_1181252808 22 Left 1181252799 22:21544685-21544707 CCTGCGGGGATGCCCTCGGGGAA No data
Right 1181252808 22:21544730-21544752 TGGGCCTTGCTCCTCAGTCCTGG No data
1181252799_1181252804 2 Left 1181252799 22:21544685-21544707 CCTGCGGGGATGCCCTCGGGGAA No data
Right 1181252804 22:21544710-21544732 TGTGGCCCAGAGGAGTTTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181252799 Original CRISPR TTCCCCGAGGGCATCCCCGC AGG (reversed) Intergenic