ID: 1181252803

View in Genome Browser
Species Human (GRCh38)
Location 22:21544700-21544722
Sequence TCGGGGAAGATGTGGCCCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181252789_1181252803 23 Left 1181252789 22:21544654-21544676 CCTAGCAAAGGGCTCAGCAGCAC No data
Right 1181252803 22:21544700-21544722 TCGGGGAAGATGTGGCCCAGAGG No data
1181252788_1181252803 28 Left 1181252788 22:21544649-21544671 CCACTCCTAGCAAAGGGCTCAGC No data
Right 1181252803 22:21544700-21544722 TCGGGGAAGATGTGGCCCAGAGG No data
1181252794_1181252803 -4 Left 1181252794 22:21544681-21544703 CCTCCCTGCGGGGATGCCCTCGG No data
Right 1181252803 22:21544700-21544722 TCGGGGAAGATGTGGCCCAGAGG No data
1181252799_1181252803 -8 Left 1181252799 22:21544685-21544707 CCTGCGGGGATGCCCTCGGGGAA No data
Right 1181252803 22:21544700-21544722 TCGGGGAAGATGTGGCCCAGAGG No data
1181252798_1181252803 -7 Left 1181252798 22:21544684-21544706 CCCTGCGGGGATGCCCTCGGGGA No data
Right 1181252803 22:21544700-21544722 TCGGGGAAGATGTGGCCCAGAGG No data
1181252787_1181252803 29 Left 1181252787 22:21544648-21544670 CCCACTCCTAGCAAAGGGCTCAG No data
Right 1181252803 22:21544700-21544722 TCGGGGAAGATGTGGCCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181252803 Original CRISPR TCGGGGAAGATGTGGCCCAG AGG Intergenic
No off target data available for this crispr