ID: 1181252805

View in Genome Browser
Species Human (GRCh38)
Location 22:21544711-21544733
Sequence GTGGCCCAGAGGAGTTTTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181252794_1181252805 7 Left 1181252794 22:21544681-21544703 CCTCCCTGCGGGGATGCCCTCGG No data
Right 1181252805 22:21544711-21544733 GTGGCCCAGAGGAGTTTTTTGGG No data
1181252802_1181252805 -10 Left 1181252802 22:21544698-21544720 CCTCGGGGAAGATGTGGCCCAGA No data
Right 1181252805 22:21544711-21544733 GTGGCCCAGAGGAGTTTTTTGGG No data
1181252799_1181252805 3 Left 1181252799 22:21544685-21544707 CCTGCGGGGATGCCCTCGGGGAA No data
Right 1181252805 22:21544711-21544733 GTGGCCCAGAGGAGTTTTTTGGG No data
1181252798_1181252805 4 Left 1181252798 22:21544684-21544706 CCCTGCGGGGATGCCCTCGGGGA No data
Right 1181252805 22:21544711-21544733 GTGGCCCAGAGGAGTTTTTTGGG No data
1181252801_1181252805 -9 Left 1181252801 22:21544697-21544719 CCCTCGGGGAAGATGTGGCCCAG No data
Right 1181252805 22:21544711-21544733 GTGGCCCAGAGGAGTTTTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181252805 Original CRISPR GTGGCCCAGAGGAGTTTTTT GGG Intergenic
No off target data available for this crispr