ID: 1181253783

View in Genome Browser
Species Human (GRCh38)
Location 22:21549776-21549798
Sequence GCTGCTTGTTCTCCTCTTGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 2, 1: 1, 2: 1, 3: 16, 4: 247}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181253778_1181253783 16 Left 1181253778 22:21549737-21549759 CCTTCTCGTCTGCCTGGTAGGGG 0: 3
1: 0
2: 0
3: 11
4: 133
Right 1181253783 22:21549776-21549798 GCTGCTTGTTCTCCTCTTGCAGG 0: 2
1: 1
2: 1
3: 16
4: 247
1181253780_1181253783 4 Left 1181253780 22:21549749-21549771 CCTGGTAGGGGCAGCCTGCACGC 0: 3
1: 0
2: 0
3: 13
4: 118
Right 1181253783 22:21549776-21549798 GCTGCTTGTTCTCCTCTTGCAGG 0: 2
1: 1
2: 1
3: 16
4: 247
1181253774_1181253783 24 Left 1181253774 22:21549729-21549751 CCGCTTCACCTTCTCGTCTGCCT 0: 3
1: 0
2: 3
3: 56
4: 588
Right 1181253783 22:21549776-21549798 GCTGCTTGTTCTCCTCTTGCAGG 0: 2
1: 1
2: 1
3: 16
4: 247
1181253781_1181253783 -10 Left 1181253781 22:21549763-21549785 CCTGCACGCCGCAGCTGCTTGTT 0: 3
1: 0
2: 0
3: 10
4: 105
Right 1181253783 22:21549776-21549798 GCTGCTTGTTCTCCTCTTGCAGG 0: 2
1: 1
2: 1
3: 16
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181253783 Original CRISPR GCTGCTTGTTCTCCTCTTGC AGG Exonic
901483128 1:9539706-9539728 GCAGCGTGTTCTCCTTCTGCTGG - Exonic
901689814 1:10965390-10965412 GCGGCTGGTTGTCCCCTTGCAGG + Intronic
901759673 1:11462553-11462575 GATGCATGTTCCCCTCTCGCAGG + Intergenic
901881942 1:12199241-12199263 GCTGCTTCTCCTCCCCTTCCAGG + Intronic
901920857 1:12536523-12536545 TCTGCTTGTAATCCTCTTCCTGG + Intergenic
902279477 1:15363874-15363896 GCAGGTGGTTCTCCTCTTGGGGG - Intronic
903996439 1:27307892-27307914 GCTGCTGCTTCTCCTGCTGCTGG + Exonic
906796493 1:48700323-48700345 GCTCCTTGTGCTCTTCTTCCAGG + Intronic
913327739 1:117641720-117641742 GCTGCTGTTGCTCCACTTGCAGG + Intergenic
916092475 1:161318399-161318421 GCTGGTTGTTCATCTCTAGCTGG - Intronic
916204912 1:162307092-162307114 TCTGCTTATTCTACTCTTTCTGG + Intronic
916418188 1:164611876-164611898 GCTGTCAGCTCTCCTCTTGCTGG - Intronic
917907993 1:179608410-179608432 ACTGCTTGTTATTTTCTTGCAGG + Intronic
919802308 1:201361290-201361312 GCTGCTTGAACTTCTCCTGCAGG + Exonic
921462546 1:215445524-215445546 GGTGATTGATCTCCTCCTGCTGG + Intergenic
921686403 1:218094008-218094030 GCTGCCTCTTCTTCTCTTGTGGG - Intergenic
922019711 1:221691420-221691442 GCTGCATTTTCCCCTCCTGCTGG + Intergenic
1063989967 10:11550405-11550427 GCTGCTTGTTTTCTTCTTACTGG - Intronic
1066153423 10:32649620-32649642 GTTGCTTATTCTCCTCTCTCAGG + Intronic
1066659966 10:37728927-37728949 CCTGCTTCTCCTCCTCTAGCTGG - Intergenic
1069304667 10:66954349-66954371 GCTTCTTGAGCTCCTTTTGCAGG + Intronic
1069640063 10:69949095-69949117 GCAGCTTGTCCTCTTCATGCCGG + Intronic
1070961914 10:80505369-80505391 GCTGCTTGTTGCCCTGTGGCAGG + Intronic
1071873042 10:89815892-89815914 GCAGCTTGTTTTCCTCTACCTGG + Intergenic
1072196240 10:93119266-93119288 TCTGCTTGTTCACCTCCTGCTGG + Intergenic
1075030340 10:119020358-119020380 GATGCTTGTTCTATTATTGCTGG + Intergenic
1075568463 10:123521276-123521298 GCTGCTAGCTCGCCTCCTGCTGG + Intergenic
1075780206 10:125012482-125012504 ACTGCTTGTTCTCTTCCTGCCGG + Intronic
1076254062 10:129006092-129006114 GCTGCTAGCTCTCCTCTTCCAGG - Intergenic
1077306503 11:1870986-1871008 GCTCCTTGGTCCCCTCCTGCGGG + Intronic
1078293754 11:10044326-10044348 GCCTTTTCTTCTCCTCTTGCGGG - Intronic
1080120398 11:28670406-28670428 TCTGCTTCTTCTGCTCTTCCTGG + Intergenic
1082205955 11:49434402-49434424 GCAGCGTGTTCTCCTTCTGCTGG + Intergenic
1082217640 11:49593755-49593777 CTTGCTTTTTCTCCTTTTGCTGG + Intergenic
1083085582 11:60140790-60140812 GCTGCCTGTGCTCTTCCTGCTGG + Intergenic
1083681379 11:64353374-64353396 GCTGCCGGTTCTCCTCTTCCTGG - Exonic
1083764390 11:64835114-64835136 GCTGCTTGCTCTCCTGCTCCTGG + Exonic
1083954651 11:65976739-65976761 GCTGCTGCTTCTCCTCGTCCAGG - Exonic
1083993730 11:66261897-66261919 GCTGCTTCTCCTCCTCGAGCTGG - Exonic
1084046229 11:66569230-66569252 GCAGCTTGATCGCCTCTTTCAGG + Intergenic
1084751225 11:71205445-71205467 CCTGCCTGTGCCCCTCTTGCTGG + Intronic
1084891986 11:72241236-72241258 GCTGCTTGCGCTTCTCGTGCAGG + Exonic
1085186204 11:74578141-74578163 GCTGCTGCTTCTCATCTGGCTGG - Intronic
1085390549 11:76179960-76179982 GCTCCTGGTTCTGCCCTTGCTGG - Intergenic
1086631935 11:89030395-89030417 CTTGCTTTTTCTCCTTTTGCTGG - Intronic
1096780752 12:53990827-53990849 GTTTCTTGTTCTTCTCTTGGCGG + Intronic
1097750772 12:63349752-63349774 GCTCCTTGTTCTGCTCTGCCTGG + Intergenic
1103096405 12:118136248-118136270 GCTGCTCGTCCACTTCTTGCAGG - Exonic
1104058535 12:125248824-125248846 GCTGCTTTTTCCCCTTCTGCAGG + Intronic
1104061775 12:125274630-125274652 GCAGCCTGTTCTCCTCTTTGGGG - Intronic
1104685311 12:130780956-130780978 GCTGCTTGTACCACCCTTGCTGG - Intergenic
1105322165 13:19337076-19337098 GCTGCTTCTTGTCCTCTAGTTGG + Intergenic
1105876301 13:24557230-24557252 GCTGCTTCTTGTCCTCTAGTTGG - Intergenic
1107452168 13:40519544-40519566 GCTGTTTGTTCTCCTCTCCTGGG - Intergenic
1108871274 13:54989228-54989250 GCTGCTTGCTGGCCTCTGGCAGG + Intergenic
1108926497 13:55753753-55753775 GCAGCTTGTTCACCTCTCGTAGG - Intergenic
1109908682 13:68880161-68880183 ACTTCTTGTTCTCCTTTTCCTGG + Intergenic
1110169960 13:72488583-72488605 GCTGCTGCTTCTCCTCATGTTGG - Intergenic
1113720657 13:112553515-112553537 GCTGCTGCTTCTCCTCCTGTTGG - Intronic
1113890517 13:113732877-113732899 GCTCCTTGTTCTCCACCTGTGGG - Exonic
1114184185 14:20387792-20387814 GCCGCTTGTTCTCTTCATGAAGG - Intronic
1114662881 14:24359790-24359812 TCTGCTTTTTCTCTTCTTGTTGG + Intergenic
1114669982 14:24405495-24405517 TCTACTTTTTCTCCTCTTGGAGG + Intronic
1116437733 14:44913028-44913050 GCTGGTTTTTGTCCTCTTCCAGG + Intergenic
1118276365 14:64389084-64389106 TCTGCCTGTTCTACCCTTGCGGG + Intronic
1120019040 14:79507536-79507558 GCTCCTTCTTTTCCTCTTCCTGG - Intronic
1120469569 14:84904850-84904872 GCAACTGGTTCTGCTCTTGCAGG + Intergenic
1121819070 14:96951366-96951388 CCAGCTCCTTCTCCTCTTGCAGG - Intergenic
1122138132 14:99646168-99646190 GCTATTTGTTTTCCTCTTGTGGG + Intronic
1122774266 14:104110293-104110315 GCTGCTAGTCCTCCTCCTGCTGG - Intronic
1123794753 15:23760564-23760586 GCTACCTGTTTTCTTCTTGCAGG - Intergenic
1123926603 15:25118825-25118847 GCTGCTTTTTCTCCTTTTGCTGG - Intergenic
1125522059 15:40353785-40353807 GCTGCGTGTTGCCCTCATGCAGG - Intronic
1127310138 15:57745174-57745196 GCTCCTTTTGCTCCTCTTGGTGG + Intronic
1127401945 15:58597227-58597249 GCTGCATTTTCTTCACTTGCAGG - Exonic
1129186578 15:73910967-73910989 GCTGCTTGCTCCCCTCTTCACGG - Intergenic
1131240178 15:90733789-90733811 CCTTCTTGCTCTCTTCTTGCCGG + Intronic
1131624051 15:94099324-94099346 GCTGCAAGTTCTCCTCTAGCAGG - Intergenic
1132231440 15:100187467-100187489 GAAGCTGGTTCACCTCTTGCGGG - Intronic
1134853295 16:17499495-17499517 GCTGCCTTTTCTCCTATAGCTGG - Intergenic
1135647045 16:24172248-24172270 GCTGTTTGCTGTCCTCTTCCAGG + Exonic
1141109407 16:81259654-81259676 TATGCTGGTTCTTCTCTTGCAGG + Exonic
1141661752 16:85445206-85445228 GCTGCTTGCTCTCCTCTCCCGGG + Intergenic
1142660181 17:1423650-1423672 TCTCCTTATTCTCCTCCTGCAGG - Exonic
1143585535 17:7848580-7848602 GTGGCTTCTTCTCCTCTTCCTGG - Exonic
1144219996 17:13091207-13091229 GATGCTCCTTCTCCTCTTTCAGG - Intergenic
1144676976 17:17168110-17168132 CCTGCTAGTTCTCCTCCTGGTGG - Intronic
1145892402 17:28426376-28426398 GCTGCTTGTTTCCCTCCTGGTGG + Intergenic
1146538079 17:33670521-33670543 GCTGCTAGTTCCCCTGTTCCAGG - Intronic
1146718108 17:35103324-35103346 TCTGCTTCTCCTCCTCCTGCAGG - Exonic
1147360901 17:39928904-39928926 GCTGCCTGTTCTGCTCTGGGTGG - Intergenic
1148262095 17:46193048-46193070 GCTGCTTTTTCTTCTCTTTCGGG + Intronic
1150656034 17:67040467-67040489 GCTGCCTGCTCTCCTCCTGCAGG + Intergenic
1151657746 17:75503574-75503596 GGTGCCTTTTCTCCTCTGGCTGG - Intronic
1153511075 18:5853296-5853318 TCTCCCTTTTCTCCTCTTGCTGG - Intergenic
1156184634 18:34647547-34647569 ACTGACTGTTCTCCTCTTCCTGG - Intronic
1156990779 18:43404866-43404888 GATGCTTGATTTCCTTTTGCAGG - Intergenic
1157936671 18:51881344-51881366 GCTACTTGTCCTTCTCTTCCAGG + Intergenic
1160222051 18:76984894-76984916 GCTCCGTGGTCTTCTCTTGCAGG - Intronic
1160561755 18:79763190-79763212 ACAGCTTGTCCTCCTTTTGCCGG + Intergenic
1160958520 19:1706463-1706485 GCTCCTGGATCTGCTCTTGCTGG - Intergenic
1162116714 19:8434442-8434464 TCTGCTTGTTTTCATTTTGCTGG + Intronic
1162818437 19:13209387-13209409 GCCGCTGGTTCTCCTCGGGCGGG + Exonic
1163311440 19:16517274-16517296 GCTCCTTGTTCACCTCCTCCAGG - Exonic
1163546185 19:17942649-17942671 GCTTCTCCTTCTCCTCCTGCGGG - Exonic
1165245760 19:34497649-34497671 GCCACTTGCTCTGCTCTTGCTGG - Intronic
1165829741 19:38724466-38724488 GCTGCTTGCTCTGCTCCTCCAGG - Exonic
1166133873 19:40763628-40763650 GCTCGTTGGTCTCCTCTGGCAGG - Exonic
1167415045 19:49365580-49365602 GCTCCTGGTTCTCCTCTTTGTGG - Exonic
1167736225 19:51296075-51296097 GCTGCTTGCTCTGCCCTTGCTGG - Intergenic
1168078476 19:53992898-53992920 GCCGCCGGTTCTCCTCTTGCAGG - Exonic
925164919 2:1710036-1710058 GCTGCGTGTGCTCCTCTGGTGGG - Intronic
925284880 2:2709392-2709414 GCTTCTTGCTCTCCTCCTTCTGG + Intergenic
925491779 2:4403124-4403146 GCTGATTCTCCTCCTATTGCTGG + Intergenic
926314344 2:11698196-11698218 GCTGTCTGTTCTCCCCTGGCCGG + Intronic
926789879 2:16559586-16559608 ACTGCTGTTTCTTCTCTTGCAGG - Exonic
926973472 2:18489842-18489864 TCTGCTGGTTCTCCTCTAGATGG - Intergenic
927645099 2:24872572-24872594 GCTGCTGGCTCTGCTCTTCCAGG + Exonic
928024075 2:27725511-27725533 GCTGTTTGCTGTCCTCTAGCCGG - Intergenic
928447815 2:31348442-31348464 GCTGCTGGTTCTCTTGTTCCTGG - Intronic
929958813 2:46480647-46480669 GCCGCTGGTTCTTCTCATGCAGG - Exonic
930066657 2:47332747-47332769 GCTGCCTGTTCCCCGCTTCCTGG - Intergenic
932071761 2:68627702-68627724 GCTTCAGGATCTCCTCTTGCAGG - Intronic
934127331 2:88909385-88909407 GTTCCTTGTTTTCCTCTTGTCGG + Intergenic
934516478 2:94991180-94991202 GCTGTTTGTTATCCACTTGGTGG - Intergenic
937362510 2:121238911-121238933 GCTGCCTGTTTTCTGCTTGCAGG - Intronic
938773664 2:134522299-134522321 GCTGCTTTCTTTCCTCTTGAGGG - Intronic
938777905 2:134558258-134558280 TCTGCTCGTGCTCCACTTGCTGG - Intronic
942277430 2:174333503-174333525 CCTGCTTGTTTTTCTCTTTCTGG - Intergenic
943611362 2:190038706-190038728 GGTGCTTTTTCTCCTTTTCCAGG + Intronic
944430554 2:199629042-199629064 TTTTCTTGTTCTTCTCTTGCAGG + Intergenic
947732062 2:232436782-232436804 GCTGCCTGTTCTCCTTCTCCCGG + Intergenic
947793491 2:232880519-232880541 CCTGCTTCCTCTCCTCCTGCCGG - Intronic
1170510845 20:17075298-17075320 CCAGCTTCCTCTCCTCTTGCTGG - Intergenic
1171935858 20:31274394-31274416 GCTCCTCGTTCTCCTCTTGTTGG - Intergenic
1173969636 20:47142247-47142269 GCTACATGTCCTCCTTTTGCAGG + Intronic
1174816427 20:53691161-53691183 TCTGCATGTTTTCCTCATGCTGG - Intergenic
1175529887 20:59667310-59667332 GCTGCTTATACTCCTATTGTGGG - Intronic
1178259403 21:31085006-31085028 GCTGCTTTTCCTTCTCATGCAGG - Intergenic
1180030010 21:45200471-45200493 GCTGCTGGTCCTCCTCTGGATGG - Intronic
1180796875 22:18610234-18610256 GCTGCTTGTTCTCCGCTTGCAGG + Exonic
1180824498 22:18853325-18853347 GCTGCATCCTCTCCTCCTGCAGG + Intronic
1181100034 22:20532825-20532847 GCTCTTTGTCCTCCTCTGGCTGG + Intronic
1181124921 22:20696480-20696502 GCTGCATCCTCTCCTCCTGCAGG + Intergenic
1181188236 22:21121223-21121245 GCTGCATCCTCTCCTCCTGCAGG - Intergenic
1181210960 22:21289270-21289292 GCTGCATCCTCTCCTCCTGCAGG + Intergenic
1181224849 22:21385037-21385059 GCTGCTTGTTCTCCTCTTGCAGG - Exonic
1181253783 22:21549776-21549798 GCTGCTTGTTCTCCTCTTGCAGG + Exonic
1181398540 22:22637618-22637640 GCTGCATCCTCTCCTCCTGCAGG - Intergenic
1181501277 22:23316976-23316998 GCTGCATCCTCTCCTCCTGCAGG - Exonic
1181650875 22:24258442-24258464 GCTGCATCCTCTCCTCCTGCAGG + Intergenic
1181706506 22:24652297-24652319 GCTGCATCCTCTCCTCCTGCAGG - Intergenic
1182173891 22:28262994-28263016 CTTGCTTGGTCTCCTCTTGTTGG - Intronic
1183075060 22:35421642-35421664 GCTGCTTCTTCCCATCTTGGAGG - Intronic
1183857463 22:40645106-40645128 GCTGATTGTTCCCCTCTTGTGGG - Intergenic
1184373976 22:44100045-44100067 GCTCCTCGTTCTCCTCTGCCAGG - Exonic
1184662753 22:45972800-45972822 GAGGCTTGTGCTCCTCTTGGGGG + Intronic
1184826094 22:46952296-46952318 GCCGCTTGTCCTCCTCTGCCTGG + Intronic
1184867567 22:47209970-47209992 GCTGCTTGTGCACCTCCCGCTGG - Intergenic
1185298135 22:50064147-50064169 GCTGCTAGTGCTCCTGCTGCAGG - Exonic
1203215985 22_KI270731v1_random:6160-6182 GCTGCATCCTCTCCTCCTGCAGG - Intergenic
1203274637 22_KI270734v1_random:79230-79252 GCTGCATCCTCTCCTCCTGCAGG + Intergenic
950332435 3:12167168-12167190 GTTGCATGCCCTCCTCTTGCTGG + Intronic
951603332 3:24401288-24401310 GCTGTTTCTTTTCCTCCTGCAGG - Intronic
952866217 3:37856933-37856955 TCTGCTTTTTCTCCTCTTTGTGG - Intergenic
953348134 3:42193142-42193164 GGTGTGTGATCTCCTCTTGCTGG - Exonic
953435121 3:42871838-42871860 GCTGCCTGTTCTGCTCTGCCAGG - Intronic
953793804 3:45967719-45967741 GCTGCTTCTTCTGCTCCTCCAGG + Exonic
954244131 3:49317342-49317364 GTTTCTTGTCCTCCTCCTGCTGG + Intronic
954294134 3:49664846-49664868 GCTGCTTGTACTCACCATGCTGG - Exonic
954445299 3:50543079-50543101 GCTGCTGGTCTTCTTCTTGCAGG + Intergenic
955343555 3:58144001-58144023 GCTGCTGGTCCTCTTCTTCCAGG - Intronic
957478661 3:80761095-80761117 TCTGTTTGTTCTTCTCTTCCTGG - Intergenic
960874673 3:122284771-122284793 GCTGCTGCTGCTGCTCTTGCTGG - Exonic
961542968 3:127612685-127612707 GGTGCTTTTTCTCCGTTTGCTGG + Intronic
961573300 3:127815964-127815986 GCTCCTTGCTCTCCTCTCCCAGG - Intronic
962415707 3:135179709-135179731 TCTGCCTCTCCTCCTCTTGCTGG - Intronic
965337893 3:167450317-167450339 GCTCCTTTTTCTCCCCTTGGTGG + Intronic
965669115 3:171128428-171128450 AATGCTTGTTCTCACCTTGCAGG + Intronic
967069745 3:185952452-185952474 CCTGGTTGTTCTGCTGTTGCTGG - Intergenic
968554275 4:1239366-1239388 ACTGCTTGGTCTCCTGTGGCCGG - Intronic
969338824 4:6527872-6527894 GCTGCCCGCTCTCCTCCTGCTGG - Intronic
969482984 4:7456752-7456774 GCTGCTTGTCCCCCTGTGGCAGG + Intronic
970355268 4:15245120-15245142 GGTGCTTCTTCTACTCTTCCAGG + Intergenic
970556238 4:17235522-17235544 GCTGCTGTTTCTCCTCTGGGTGG - Intergenic
973305403 4:48643075-48643097 GCTGACTTTTCTCCTCTAGCTGG + Intronic
977418110 4:96761619-96761641 GCTCCTTTATATCCTCTTGCTGG + Intergenic
980693871 4:136330522-136330544 GTTGCTTACTCTCCTCTTTCAGG - Intergenic
980937249 4:139237787-139237809 GCTGCTTATTCACCTCTGACTGG - Intergenic
982206709 4:153001991-153002013 CCTGCTTGTTCTCTTCTCCCTGG + Intergenic
984436643 4:179718482-179718504 CCTGCTTTTTCTAGTCTTGCTGG + Intergenic
984550045 4:181148750-181148772 GCTGCCTTTTCTTCTCCTGCTGG + Intergenic
985394847 4:189531281-189531303 AGTTCTTGTTCTCCACTTGCAGG + Intergenic
987225582 5:15837416-15837438 GTTGCTTTTTTTCCTCTTGATGG - Intronic
987600641 5:20065051-20065073 GATGCTTTCTCTCTTCTTGCAGG + Intronic
987639642 5:20596091-20596113 GTTGTTTGCTGTCCTCTTGCTGG + Intergenic
989459443 5:41680569-41680591 CCTTCTTTTTCTCCTCTTCCTGG - Intergenic
991000307 5:61776163-61776185 GATGCATACTCTCCTCTTGCCGG - Intergenic
991425736 5:66489832-66489854 GCTGCTTCTTCTCCTCTCAACGG + Intergenic
991647307 5:68814025-68814047 TCTGCTTTTTCTTCTCTTCCTGG + Intergenic
998037940 5:138932461-138932483 CATGCTTCCTCTCCTCTTGCTGG - Intronic
998373371 5:141675170-141675192 GCTGCTTTTTCTCATCCTTCAGG + Intronic
999535962 5:152517890-152517912 GCTGGTTGCTCTGCTCTTCCGGG + Intergenic
1000973456 5:167739548-167739570 GCTCCTGGTTCCCATCTTGCTGG + Intronic
1001476509 5:172054667-172054689 TCTGCCTCTTCTCCTCCTGCTGG + Exonic
1002210185 5:177594261-177594283 GCTGGTAGTTCTGCTCTTTCTGG - Exonic
1002584194 5:180231493-180231515 GCTGCCTTTTCTACCCTTGCTGG - Intergenic
1005898546 6:30198121-30198143 GCTGCTGGTTCTCTTCTGCCAGG - Intronic
1006507129 6:34496468-34496490 GCTGCTCGGCCTCCTCCTGCTGG + Intronic
1006622571 6:35376578-35376600 GCAGCTTGTTTGCCTCTGGCGGG + Intronic
1007714789 6:43849481-43849503 CCTGCTTCTTCTCCTCTCCCTGG - Intergenic
1007844618 6:44742898-44742920 GCTGCTGGTTCTACTCATGAGGG + Intergenic
1008301320 6:49844038-49844060 ATTGCTTGCTCTCCTCTTGTAGG - Intronic
1008659033 6:53646587-53646609 TCTCCTTGTTCTTCTCTTTCTGG - Intergenic
1011345170 6:86361404-86361426 GCTGCTTGTTCTCAGTTTCCTGG - Intergenic
1012913210 6:105139784-105139806 GCTCCCTGGTCTCCTCCTGCTGG + Intergenic
1013927247 6:115488082-115488104 GCTGCTTATCCTCCTCCTTCTGG - Intergenic
1014240381 6:119011374-119011396 GCTGATTTTTATCCTCTTCCAGG + Exonic
1014772071 6:125468224-125468246 GCTGCTAGTTTTTCTCTTGTCGG - Intergenic
1015683433 6:135833374-135833396 GCTGCCAGCTCTCCTCTAGCTGG - Intergenic
1016725922 6:147366984-147367006 GCTAATTGTTCTCCTCATGATGG - Intronic
1017881373 6:158564933-158564955 GCTGCTTGTTCAACTCATGCCGG - Intronic
1019669471 7:2269639-2269661 GCTGTGTGTTTTCCTTTTGCAGG - Exonic
1019934770 7:4246989-4247011 GCTGCTTCTGCTGCTTTTGCTGG - Intronic
1020989394 7:15178546-15178568 GCTGCTTTTTTTCCTCTATCTGG + Intergenic
1024930786 7:54665074-54665096 ACTTCTTTTTCTCCTCTTCCTGG - Intergenic
1025769428 7:64490329-64490351 GTTGCTTGTTCGCCTCCTGTAGG + Intergenic
1028098604 7:86793131-86793153 TCTGCCTCTTCTCCTCTTCCAGG - Intronic
1029371851 7:100155357-100155379 GCTGCTGGGGCTGCTCTTGCGGG + Exonic
1029513589 7:101012228-101012250 GGTGCTTGGGCTCCACTTGCTGG + Intronic
1032748634 7:134813797-134813819 GCTGCGTGTTTTCCTCCAGCTGG + Intronic
1035127615 7:156619793-156619815 CCTGTTTGTTCTCCTTTGGCTGG + Intergenic
1035589596 8:802479-802501 GCTGCTGCTTCTCAACTTGCTGG + Intergenic
1036132853 8:6132506-6132528 GCTGCTTGTTTTCCACTTAAAGG - Intergenic
1037818841 8:22125871-22125893 GCTGCCTGGTCCACTCTTGCTGG - Intronic
1038538015 8:28368527-28368549 GCTGCTGGGTCTCCACTTGTGGG - Intronic
1039224538 8:35373505-35373527 CATGCTTGTTCTCCTTGTGCTGG + Intronic
1045506243 8:102780840-102780862 TCTACTTGTTCTCTTCTAGCTGG - Intergenic
1046214211 8:111120713-111120735 GCTACTTGGTCATCTCTTGCTGG + Intergenic
1047181961 8:122597187-122597209 TCTGTTTCTTCTCCTCTGGCTGG + Intergenic
1048608141 8:135991461-135991483 GCTGCTCCATCTCCTCCTGCTGG + Intergenic
1048941375 8:139403453-139403475 TCTGCTTGCTCTCCTCTGGGTGG + Intergenic
1049689404 8:143952105-143952127 GCTGCTTGTTGGCCGCCTGCCGG - Intronic
1050026792 9:1343248-1343270 GCTACTTGTTCCCCTCTCGGTGG + Intergenic
1051141329 9:13982132-13982154 GCTTTTTCTTCTCCTCTGGCAGG - Intergenic
1053044658 9:34905287-34905309 GGTGCTTGTTCTCCTCTGGTAGG - Intergenic
1053135992 9:35650560-35650582 GCTGCTATTTCTCATCTCGCTGG - Exonic
1057217561 9:93237872-93237894 GCTGTATGTTCTCTTCTTTCTGG + Intronic
1061146994 9:128805855-128805877 GCTTGATGTTCTGCTCTTGCTGG - Exonic
1061430351 9:130526871-130526893 GCTGCATGTTCTGTCCTTGCGGG - Intergenic
1062430978 9:136526774-136526796 GGGGCGTGTTTTCCTCTTGCTGG - Intronic
1062515095 9:136929273-136929295 GCCGCTTGTTCAGCTCTTGGAGG + Intronic
1185513228 X:678382-678404 GCTGGTTGTTCTACTGTTGGGGG - Intergenic
1185513309 X:678776-678798 GCTGGTTGTTCTACTGTTGGGGG - Intergenic
1187032335 X:15500881-15500903 GGTGCTTGGTCTGCTGTTGCAGG - Intronic
1190745730 X:53320922-53320944 GCAGCTGGCTCTCCTCTCGCAGG + Exonic
1195611990 X:106877966-106877988 TCTGCTTGTCTTCCTTTTGCAGG + Intronic
1196032604 X:111107470-111107492 GCTTCTTTTTATCCACTTGCAGG - Intronic
1199785845 X:151104056-151104078 GCTGCTTTTTCTCTTTTCGCTGG + Intergenic
1200991679 Y:9353215-9353237 TCTGCATGTTCTCCTCATGTGGG + Intergenic
1200994334 Y:9373491-9373513 TCTGCATGTTCTCCTCATGTGGG + Intronic
1200996999 Y:9393831-9393853 TCTGCATGTTCTCCTCATGTGGG + Intergenic
1200999513 Y:9462383-9462405 TCTGCATGTTCTCCTCATGTGGG + Intergenic
1201002168 Y:9482689-9482711 TCTGCATGTTCTCCTCATGTGGG + Intronic
1201004833 Y:9502976-9502998 TCTGCATGTTCTCCTCATGTGGG + Intergenic
1201007487 Y:9523301-9523323 TCTGCATGTTCTCCTCATGTGGG + Intergenic
1201927045 Y:19298723-19298745 GTTGCTTTTTCACCTCTTGTAGG + Intergenic