ID: 1181256777

View in Genome Browser
Species Human (GRCh38)
Location 22:21567908-21567930
Sequence GCGCAGGCTCAAGGTGCTAA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 85}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181256763_1181256777 24 Left 1181256763 22:21567861-21567883 CCGTCTGGCTTCCTGCCCTACAC 0: 1
1: 0
2: 4
3: 44
4: 345
Right 1181256777 22:21567908-21567930 GCGCAGGCTCAAGGTGCTAACGG 0: 1
1: 0
2: 0
3: 5
4: 85
1181256768_1181256777 8 Left 1181256768 22:21567877-21567899 CCTACACGGCCTCGTCGGTTCCC 0: 1
1: 0
2: 0
3: 1
4: 29
Right 1181256777 22:21567908-21567930 GCGCAGGCTCAAGGTGCTAACGG 0: 1
1: 0
2: 0
3: 5
4: 85
1181256765_1181256777 13 Left 1181256765 22:21567872-21567894 CCTGCCCTACACGGCCTCGTCGG 0: 1
1: 0
2: 0
3: 4
4: 40
Right 1181256777 22:21567908-21567930 GCGCAGGCTCAAGGTGCTAACGG 0: 1
1: 0
2: 0
3: 5
4: 85
1181256771_1181256777 -1 Left 1181256771 22:21567886-21567908 CCTCGTCGGTTCCCTGGGCCGCG 0: 1
1: 0
2: 0
3: 7
4: 56
Right 1181256777 22:21567908-21567930 GCGCAGGCTCAAGGTGCTAACGG 0: 1
1: 0
2: 0
3: 5
4: 85
1181256767_1181256777 9 Left 1181256767 22:21567876-21567898 CCCTACACGGCCTCGTCGGTTCC 0: 1
1: 0
2: 0
3: 0
4: 19
Right 1181256777 22:21567908-21567930 GCGCAGGCTCAAGGTGCTAACGG 0: 1
1: 0
2: 0
3: 5
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181256777 Original CRISPR GCGCAGGCTCAAGGTGCTAA CGG Intronic
902569625 1:17338807-17338829 GCGCTGGAGGAAGGTGCTAAGGG + Intronic
903622183 1:24705781-24705803 ACGGAGGCCCAAGGAGCTAAGGG - Intergenic
906034797 1:42743582-42743604 ACACAGTCTCAAGGTGCTCAGGG - Intergenic
906788831 1:48641010-48641032 GAGCAGCCTCACGGTGCTCAGGG - Intronic
922087907 1:222368787-222368809 GCGAAGGGCCAAGGTCCTAAGGG - Intergenic
924073071 1:240303111-240303133 GCGCAGCCTCAGGGTACAAAAGG - Intronic
1062771482 10:104869-104891 GCCCAGGCTGTAGGTGCCAAGGG + Intergenic
1063608214 10:7541470-7541492 GCGCAGGCCCAAGATCCGAAAGG + Intergenic
1064576517 10:16751506-16751528 GAGCAGGCTCATGTGGCTAATGG - Intronic
1066253150 10:33653585-33653607 GCTCAGGCTCAAGGTAGCAAAGG - Intergenic
1074257094 10:111813614-111813636 GCGAAGGCACAAGGGGCTTAGGG - Intergenic
1074781645 10:116806680-116806702 GCCCTGGCTCACAGTGCTAAGGG + Intergenic
1074991582 10:118713023-118713045 GCCCAGGCTGTAGGTGCCAAGGG + Intronic
1075007762 10:118842743-118842765 GCCCAGGCTGTAGGTGCCAAGGG - Intergenic
1077174048 11:1180769-1180791 GAGCAGGCTCGAGGGGCTCAGGG + Intronic
1078829934 11:14969327-14969349 GCTCAGGCTCAAGGTACACAGGG + Intronic
1088513244 11:110599475-110599497 GCCCAGGCTATAGGTGCAAAGGG - Intronic
1089379246 11:118015778-118015800 GATCAGGCCCAAGGTGCTGATGG + Intergenic
1090514690 11:127412475-127412497 GCCCAGGCTGTAGGTGCCAAGGG + Intergenic
1091230424 11:133984526-133984548 GCACAGCCTCAAGGGGCTAAGGG + Intergenic
1091312254 11:134582960-134582982 GGGCAGGCCAAAGGTCCTAAAGG + Intergenic
1097299038 12:57998295-57998317 ACCCAGGCTGTAGGTGCTAAGGG + Intergenic
1109728758 13:66381936-66381958 GGGCAAGCTCAATGTGATAAGGG + Intronic
1110285132 13:73741005-73741027 ACACAGTCTCAAAGTGCTAACGG + Intronic
1114635501 14:24184665-24184687 GCACAGGCTGAAGGTCCTCACGG + Exonic
1120997761 14:90429297-90429319 GCCCAGGCTAAAGGGGCTACAGG - Intergenic
1121875323 14:97445955-97445977 CAGCAGGCTCCAGGTGCTTATGG - Intergenic
1123025258 14:105420941-105420963 GCGCAGGCTGCAGGTGGGAAAGG - Intronic
1134078449 16:11308597-11308619 GCCCAGGCTGTAGGTGCCAAGGG + Intronic
1140351265 16:74263918-74263940 GCACAGAGGCAAGGTGCTAACGG + Intergenic
1150952769 17:69821663-69821685 GCCCAGGCTGTAGGTGCCAAGGG - Intergenic
1153734719 18:8053749-8053771 GGGCAGACTCAATGTGGTAAAGG - Intronic
1161780140 19:6286377-6286399 GCCCAGGCTATAGGTGCCAAGGG - Intergenic
1162039814 19:7963915-7963937 GCGCAGCCACGAGGTGCTCACGG + Intronic
1162805964 19:13138250-13138272 GCCCAAGGTCAAGGTGCTCAAGG + Exonic
1165349305 19:35267719-35267741 GCGCAGGCTCAAGAAGGTGAGGG + Exonic
1165399293 19:35587405-35587427 GCCCAGTGTCAAGGAGCTAAAGG - Intergenic
1167513105 19:49907222-49907244 GTACAGGCTCAGGGTGCTACGGG + Intronic
925317506 2:2937275-2937297 GTGCACGCTCAAGGTGATGACGG + Intergenic
925317526 2:2937370-2937392 GTGCACGCTCAAGGTGATGATGG + Intergenic
925317545 2:2937465-2937487 GTGCACGCTCAAGGTGATGACGG + Intergenic
926887490 2:17611659-17611681 GTGGTGGCTCAAGGTGCGAAAGG + Intronic
938266566 2:129932568-129932590 CCCCAGGCTCCAGGAGCTAAGGG - Intergenic
938344483 2:130557330-130557352 CCACAGGCTCAAGGTGCCAAGGG + Intergenic
938345350 2:130563392-130563414 CCACAGGCTCAAGGTGCCAAGGG - Intergenic
938972292 2:136443511-136443533 GAGCAGGCCCAAAGTGCTCATGG + Intergenic
940013310 2:149077729-149077751 GAGCTGGCTCACTGTGCTAATGG - Intronic
942185358 2:173420272-173420294 GGGCAGGCTCAGGGTGCTTTAGG + Intergenic
946225387 2:218261616-218261638 GCCCAGGCTCAGGGTGCTGGGGG + Intronic
947581269 2:231320397-231320419 GCACAATCTCAAGTTGCTAACGG + Intronic
947989364 2:234474582-234474604 GCACAGGCTCAGGGTGCCCATGG - Intergenic
1170654708 20:18275834-18275856 GCTCAGTCTCAAGGTAATAAAGG - Intergenic
1171374998 20:24686365-24686387 GCGCAGCCTCAAGGCGCTGAGGG - Intergenic
1181256777 22:21567908-21567930 GCGCAGGCTCAAGGTGCTAACGG + Intronic
1181341373 22:22182461-22182483 CTGCAGGATCAGGGTGCTAAGGG - Intergenic
1183476437 22:38038557-38038579 GCGCGGGCGCAAGGGGCTCAAGG - Intronic
949982005 3:9507993-9508015 GTGCAGGCTCAAGGTCCCCACGG - Intronic
955303777 3:57809515-57809537 GCCCAGGCTGTAGGTGCCAAGGG - Intronic
961459270 3:127039924-127039946 GGGCAGACTCAAGGGGCTGACGG - Intergenic
964955810 3:162354456-162354478 GAGCAGGCTTAAGGTTCTTAAGG + Intergenic
968878770 4:3288079-3288101 ACGCAGGCTCAGGGAGCTCAGGG - Intergenic
969054049 4:4390650-4390672 GAGCAGGGTCAAGGTGTTATAGG - Intronic
970406549 4:15769534-15769556 GCTCAGGCTCAAAGAGCTAGTGG + Intergenic
970483216 4:16498690-16498712 GCCCAGGTTCAAGGCACTAAAGG - Intergenic
972664247 4:41148610-41148632 GGGAAGGCTCAGGGGGCTAAAGG + Intronic
972931085 4:44072170-44072192 GCCCAGGCTGTAGGTGCCAAGGG + Intergenic
979586452 4:122424059-122424081 TGGCAGGTTCAAGGTGCTGAAGG + Intronic
980738242 4:136918096-136918118 GCCCAGGCTCTAGGTTCCAAGGG - Intergenic
997836678 5:137200013-137200035 GCGCAGGCTCAGGGCACTAGGGG - Intronic
1002175757 5:177400243-177400265 GCGCGCGCTCCTGGTGCTAATGG - Exonic
1018095792 6:160386105-160386127 GCCCGTGCTCAAGGTGCTCAAGG - Intronic
1021961837 7:25880925-25880947 ATGCAGGGTCAAGGTGGTAAAGG - Intergenic
1024803260 7:53105950-53105972 GCGCATGCTCAGGGAGGTAAGGG + Intergenic
1028384745 7:90242384-90242406 GCACAGGCTGAAGCTGATAAGGG - Intergenic
1028930496 7:96408208-96408230 GCGCAGGCTGAAAGAGCTGAAGG + Intergenic
1032531862 7:132627792-132627814 GTCCAGGATCAAGGTGCTAGTGG - Intronic
1036757694 8:11482216-11482238 GCTCAGGCTCGAGGCGCTAGGGG - Intergenic
1038279052 8:26147086-26147108 GCCAAGGCTCAAGGTTTTAAAGG - Intergenic
1040332287 8:46391751-46391773 GGGCCGGCTCAAGGTACTATGGG + Intergenic
1044524999 8:93241741-93241763 GCCCAGGCTGTAGGTGCTGAGGG + Intergenic
1048421735 8:134284224-134284246 GCCCAGGCTGTAGGTGCCAAGGG + Intergenic
1049176071 8:141193444-141193466 GCGCAGGTTCACGGTGCAAGAGG - Intronic
1058083770 9:100727038-100727060 GCTCAGGCTCTAGGATCTAATGG - Intergenic
1058311094 9:103503732-103503754 GCTAAGGGTCAAGTTGCTAAAGG + Intergenic
1062344395 9:136108245-136108267 GGGCAGGCCCAAGGTGCTAGGGG + Intergenic
1191883506 X:65865112-65865134 GCTCAGGCTCAAGCTCCTGAAGG + Intergenic
1195126474 X:101813738-101813760 GCCCAGGCTGTAGGTGCCAAGGG - Intergenic
1195178603 X:102334394-102334416 GCCCAGGCTGTAGGTGCCAAGGG - Intergenic
1195180261 X:102352689-102352711 GCCCAGGCTGTAGGTGCCAAGGG + Intergenic
1195567803 X:106363165-106363187 GCTCAGGGGCAGGGTGCTAAGGG + Intergenic
1198528004 X:137521604-137521626 GCACAGGCTCCAGGAGATAATGG - Intergenic