ID: 1181256849

View in Genome Browser
Species Human (GRCh38)
Location 22:21568159-21568181
Sequence CGGTTCCGCGGCGCGGGCTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 3, 3: 6, 4: 108}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181256849_1181256866 26 Left 1181256849 22:21568159-21568181 CCGGAGCCCGCGCCGCGGAACCG 0: 1
1: 0
2: 3
3: 6
4: 108
Right 1181256866 22:21568208-21568230 GCTTGCAGCTCCGCTTGGCCCGG 0: 1
1: 0
2: 2
3: 10
4: 145
1181256849_1181256859 3 Left 1181256849 22:21568159-21568181 CCGGAGCCCGCGCCGCGGAACCG 0: 1
1: 0
2: 3
3: 6
4: 108
Right 1181256859 22:21568185-21568207 CGCCCTGGGCCGCAGCGCGCCGG 0: 1
1: 0
2: 1
3: 25
4: 204
1181256849_1181256860 4 Left 1181256849 22:21568159-21568181 CCGGAGCCCGCGCCGCGGAACCG 0: 1
1: 0
2: 3
3: 6
4: 108
Right 1181256860 22:21568186-21568208 GCCCTGGGCCGCAGCGCGCCGGG 0: 1
1: 0
2: 3
3: 30
4: 281
1181256849_1181256864 21 Left 1181256849 22:21568159-21568181 CCGGAGCCCGCGCCGCGGAACCG 0: 1
1: 0
2: 3
3: 6
4: 108
Right 1181256864 22:21568203-21568225 GCCGGGCTTGCAGCTCCGCTTGG 0: 1
1: 0
2: 0
3: 10
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181256849 Original CRISPR CGGTTCCGCGGCGCGGGCTC CGG (reversed) Intronic
900471219 1:2855957-2855979 CGTTTCCGCGGCGCAGGCTCCGG + Intergenic
900626585 1:3611370-3611392 GGGCTCCGCGGAGCGGGCGCGGG - Exonic
901279948 1:8026212-8026234 TGGCTCAGCGCCGCGGGCTCAGG + Exonic
901361305 1:8703222-8703244 GGGCACCGCGGCGCGGGCGCAGG + Intronic
903950715 1:26994431-26994453 CGGGGCCGCGGGGCGGGCTGCGG - Exonic
906314197 1:44775786-44775808 GGGTTCCGGGCCGCGGGCTGCGG + Intronic
918511987 1:185321807-185321829 CGGTTGGGCGGCGGAGGCTCAGG + Intergenic
921167052 1:212514921-212514943 CAGTCCGGCGGCGCTGGCTCCGG - Intergenic
922809219 1:228406646-228406668 GGGTGCGGCGGCGCAGGCTCGGG + Exonic
923318550 1:232805673-232805695 CGGTTCGGCGGCGGGAGCGCCGG - Exonic
924699706 1:246439000-246439022 CCGGTCCTCGGCCCGGGCTCTGG + Intronic
1063115418 10:3068522-3068544 CGGCGCCGCGGCGCGGGCTCCGG + Intronic
1065099925 10:22321954-22321976 CGGCGGCGCGGCGCGGGCTGCGG - Intronic
1067091226 10:43266694-43266716 TGGGGCCGGGGCGCGGGCTCCGG - Intronic
1075119143 10:119651625-119651647 CGGGTGCGGGGCGCTGGCTCCGG - Exonic
1075207009 10:120456976-120456998 CGGGTGCCCGGCGCGGGCCCAGG + Exonic
1075999825 10:126905684-126905706 CGGGGCGGCGGCGCGGGCGCGGG - Intronic
1077049702 11:561156-561178 CCGTTCCGCAGGGCGGGCGCAGG - Exonic
1078594341 11:12674166-12674188 CCGTCTCCCGGCGCGGGCTCCGG - Intergenic
1083659803 11:64246777-64246799 CGGCTCCGCGGCGAGGGCGGCGG + Exonic
1084376712 11:68782957-68782979 AGGCCCCGCGGCGCCGGCTCAGG + Intronic
1088401063 11:109422945-109422967 CCGGGCCGCCGCGCGGGCTCCGG - Intronic
1091266623 11:134276573-134276595 CCGTCCCGAGGCGCGGGCGCCGG - Intronic
1091266632 11:134276629-134276651 CGGTTCCGCGGGGCAGGCTCAGG - Intronic
1091550106 12:1530465-1530487 TGGGCCCGAGGCGCGGGCTCGGG - Intronic
1093464953 12:19439774-19439796 GGGTTCGGCGGCGCGGGGCCGGG + Exonic
1095261594 12:40105307-40105329 CGGCTCCGCGGTGCTGGCTGCGG - Exonic
1099315526 12:81078239-81078261 CGGGCCCGCGGGGCGGTCTCGGG + Exonic
1103048834 12:117761422-117761444 CGGATCCACGGGGTGGGCTCCGG + Exonic
1103764575 12:123271390-123271412 AACTTTCGCGGCGCGGGCTCGGG + Intronic
1116817918 14:49599935-49599957 CGGGGCCGGGGCGGGGGCTCCGG + Intronic
1122750416 14:103928659-103928681 TGGTCCCGCGGCCCAGGCTCCGG + Exonic
1122961135 14:105094012-105094034 CGGCTTCGCGGCTCCGGCTCTGG - Intergenic
1129162124 15:73752871-73752893 GGGTTCGGCGGCCCGGGCGCAGG + Intergenic
1131174533 15:90201537-90201559 GTGTCCCGCGGCTCGGGCTCAGG - Exonic
1132495876 16:263210-263232 CGGGTCCCCGGGGCGGCCTCAGG - Intronic
1132879536 16:2155885-2155907 CGGTCCCGAGGCGCGAGCCCCGG - Intronic
1135607337 16:23836038-23836060 CGCTTCCCCTGCGCCGGCTCTGG - Exonic
1139528519 16:67530345-67530367 CGGTTCCGGGGTGGGGGGTCCGG + Intronic
1142876385 17:2853896-2853918 GGGGGCCGGGGCGCGGGCTCAGG + Intronic
1148755767 17:49972239-49972261 CGGTGCCGCCGCGGGGGATCTGG - Intronic
1149833679 17:59893365-59893387 CGGGGCGGCGGCGCGGGCTCAGG + Intronic
1151314267 17:73312057-73312079 GGGTTGCGCGGGGCGGGCGCGGG - Exonic
1151729912 17:75904979-75905001 CTGCTCCGCAGCGCGGGCCCGGG - Exonic
1152356766 17:79811340-79811362 CGGTTCCGGCGCGCGTGTTCTGG + Intergenic
1153794272 18:8608904-8608926 CGGCCCGGCGGCGCGGCCTCAGG + Intergenic
1157279106 18:46334197-46334219 CGGCTCCGGGGCGCGGGCGCGGG - Intronic
1160454905 18:78993217-78993239 CGGGTCCTCGGCGCTGGCTTTGG - Exonic
1161101791 19:2425195-2425217 GGGGGTCGCGGCGCGGGCTCGGG - Exonic
1161998696 19:7730239-7730261 GGGTTCGGCCCCGCGGGCTCAGG + Intronic
1162144437 19:8605242-8605264 CCGTGCCGCGGCGCTGCCTCCGG + Exonic
1165728715 19:38130532-38130554 CGCTTCGGCGGAACGGGCTCGGG + Exonic
926267983 2:11344075-11344097 CCGTCCCCCGGCGCGGTCTCGGG + Exonic
927472255 2:23385363-23385385 CGGGCTCGCGGCTCGGGCTCCGG - Exonic
927576787 2:24207476-24207498 CTGTTCAGAGGCGCGGGCTTGGG + Intronic
929966911 2:46542991-46543013 CGGGGCCGGGGCGGGGGCTCCGG + Exonic
938455668 2:131460943-131460965 CGGGGCCGGGGCGGGGGCTCCGG + Intergenic
941580670 2:167292999-167293021 CGCTTCCCCGGCGATGGCTCTGG - Intergenic
945241557 2:207681464-207681486 CGGCTCCGCGGCGAGGGCGGCGG - Intergenic
1168756775 20:324182-324204 CGGCTCCGCGGCGCGGGGGGCGG - Intergenic
1171963728 20:31514407-31514429 CGCGTGCGCGGCGCGGGCTTGGG + Exonic
1172274981 20:33674444-33674466 CGGCGCCGACGCGCGGGCTCAGG + Intronic
1172474570 20:35226999-35227021 CGGGGCCGGGGCGCGGGCTCGGG + Intronic
1172543613 20:35742045-35742067 CGGTTCCGCGGCCTGGGCCTAGG - Intronic
1173691776 20:44966492-44966514 AGGGTCTGCGGGGCGGGCTCAGG + Exonic
1175439648 20:58981551-58981573 GGGTCCCGCGGCGCGGCCGCCGG + Intronic
1176068845 20:63215813-63215835 CGGGGCCGAGGCGCGGGGTCTGG - Intronic
1176110113 20:63407251-63407273 TGGTACGGCGGCGCCGGCTCCGG + Exonic
1179882770 21:44300352-44300374 CTCTTCCCCGGCGCGGTCTCCGG + Intronic
1181026741 22:20131522-20131544 CGGCTCCGCGGCCCGGGACCAGG + Intronic
1181256849 22:21568159-21568181 CGGTTCCGCGGCGCGGGCTCCGG - Intronic
1182576478 22:31276579-31276601 CGGCTCCGCGGCGAGGGCGGCGG - Intronic
1185255176 22:49827696-49827718 GGCTCGCGCGGCGCGGGCTCGGG + Intergenic
954121789 3:48504063-48504085 AGGATCCGCGGCGCGGGGACCGG + Exonic
955228523 3:57079601-57079623 GGTTTCCGCGGCGCGTTCTCTGG - Intergenic
966864342 3:184248886-184248908 CGGTTCCGCGGCCCAGGCAGAGG - Exonic
968674614 4:1871003-1871025 CGGCTCGGGGGCGCCGGCTCCGG + Intergenic
985129011 4:186723561-186723583 CCGGTCCCCGGCTCGGGCTCCGG - Intronic
985445108 4:190017491-190017513 CGGTGCCACGGCGCGTTCTCTGG + Intergenic
998334076 5:141355428-141355450 AGGTGCCGCTGCGCGGGTTCAGG - Exonic
998398125 5:141832715-141832737 CGGTTCCGTGGCATTGGCTCAGG + Intergenic
1003139181 6:3456826-3456848 CAGTTCCGCGGCCCGGGCGCCGG + Intronic
1004615085 6:17281551-17281573 CCGCCCCGCGGCTCGGGCTCCGG - Exonic
1005856002 6:29863869-29863891 GGGTTCCGGGACGCGGGATCCGG - Intergenic
1016400851 6:143678233-143678255 CGCTCCCGCCGCGCGGGCGCAGG + Intronic
1018612654 6:165660740-165660762 CGTTTCCGCGGCGCCTTCTCTGG - Intronic
1018621181 6:165731093-165731115 GGGTTCCGCGGCGCGGCATGGGG - Intronic
1023842438 7:44104843-44104865 CGGACCCGCGGGGTGGGCTCGGG - Exonic
1024993807 7:55255674-55255696 GCGTTCCAGGGCGCGGGCTCTGG - Intronic
1027774086 7:82443586-82443608 CGGCTCCGCGCCTCGGGCCCCGG - Exonic
1028391380 7:90321178-90321200 CGGTTCCGCTGAGCGAGCTTGGG - Intergenic
1031401290 7:121328844-121328866 CGGCTCCGCGGGGGGCGCTCCGG - Intronic
1031997231 7:128240891-128240913 GGGCTCCGCGGAGCGGGCTGGGG - Intergenic
1032130726 7:129225257-129225279 CCGGTCCCCGGCCCGGGCTCGGG + Exonic
1033732746 7:144195398-144195420 TGGGTCCGGGGCGCAGGCTCCGG - Intronic
1033743597 7:144293978-144294000 TGGGTCCGGGGCGCAGGCTCCGG - Intergenic
1033750305 7:144355619-144355641 TGGGTCCGGGGCGCAGGCTCCGG + Intronic
1034441207 7:151086844-151086866 CAGTTCGGCGGCGCGGGGCCCGG + Exonic
1037450645 8:19013532-19013554 CGGGGCCGGGGCGCGGGCGCGGG - Intronic
1038205297 8:25459176-25459198 CGGTACCGAGGGGCGGGGTCGGG + Exonic
1038554088 8:28494445-28494467 TGGCTCCTCGGCGCGGGCTGAGG - Intronic
1040423327 8:47260708-47260730 GGGTTCCGCGGAGCTCGCTCTGG - Exonic
1049396471 8:142403270-142403292 CGGCTCCGCGCCGGGGCCTCTGG - Intergenic
1049620942 8:143598015-143598037 CGGGGCCGCGGCCCGGGCGCGGG - Exonic
1049659917 8:143815377-143815399 CGGGTGGGCGGCGCGGGCTCCGG + Exonic
1053435151 9:38069270-38069292 CGGCGGCGCGGGGCGGGCTCTGG - Intergenic
1053550918 9:39078714-39078736 CGGCTCCCCGGCGCGGGAACTGG - Exonic
1053815027 9:41898793-41898815 CGGCTCCCCGGCGCGGGAACTGG - Exonic
1054615569 9:67288648-67288670 CGGCTCCCCGGCGCGGGAACTGG + Intergenic
1057054495 9:91950167-91950189 AGGTTCCTTGGCGCGGGCTGGGG + Intergenic
1060200939 9:121651563-121651585 CGGCCCCGCGGCGGGGGCTGGGG - Intronic
1060770113 9:126326616-126326638 CGGGGCGGCGGCGCGGGCTCGGG + Intergenic
1061293718 9:129666175-129666197 CGGGGCCGGGGCGCGGGGTCCGG + Intronic
1187067298 X:15854210-15854232 CTCAGCCGCGGCGCGGGCTCGGG + Intronic
1190017177 X:46836985-46837007 CGGTTCCGCGGGGCGTTGTCCGG + Exonic
1195278913 X:103310727-103310749 CGGTCCCGCGGCGGGGCCCCGGG + Exonic
1198205407 X:134460411-134460433 GGGATCCGCAGTGCGGGCTCGGG + Intronic
1198534007 X:137569110-137569132 CCGTTCCGCGGCCCGGCGTCGGG - Intronic