ID: 1181263913

View in Genome Browser
Species Human (GRCh38)
Location 22:21619031-21619053
Sequence GGTAGTAATTCTCCTGTTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 77}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181263910_1181263913 5 Left 1181263910 22:21619003-21619025 CCCAGTGAGGTTTCTAAAATGCT No data
Right 1181263913 22:21619031-21619053 GGTAGTAATTCTCCTGTTACAGG 0: 1
1: 0
2: 0
3: 7
4: 77
1181263911_1181263913 4 Left 1181263911 22:21619004-21619026 CCAGTGAGGTTTCTAAAATGCTA 0: 1
1: 0
2: 2
3: 33
4: 202
Right 1181263913 22:21619031-21619053 GGTAGTAATTCTCCTGTTACAGG 0: 1
1: 0
2: 0
3: 7
4: 77
1181263908_1181263913 16 Left 1181263908 22:21618992-21619014 CCTGTCCTTAGCCCAGTGAGGTT 0: 1
1: 0
2: 0
3: 10
4: 111
Right 1181263913 22:21619031-21619053 GGTAGTAATTCTCCTGTTACAGG 0: 1
1: 0
2: 0
3: 7
4: 77
1181263909_1181263913 11 Left 1181263909 22:21618997-21619019 CCTTAGCCCAGTGAGGTTTCTAA 0: 1
1: 0
2: 2
3: 11
4: 116
Right 1181263913 22:21619031-21619053 GGTAGTAATTCTCCTGTTACAGG 0: 1
1: 0
2: 0
3: 7
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181263913 Original CRISPR GGTAGTAATTCTCCTGTTAC AGG Intronic
905520053 1:38590539-38590561 TGTAGTAGTTCTCCTGTTAGTGG - Intergenic
912935357 1:113999403-113999425 GGTAGTGAGTTCCCTGTTACTGG + Intergenic
916629634 1:166598144-166598166 GGTATTAATTATCCTGTTTTTGG - Intergenic
917944816 1:179958667-179958689 ACTAGTAGTTCTCATGTTACAGG + Intronic
923769446 1:236925354-236925376 AGTAGTGAGTCTCCTGTCACTGG + Intergenic
923814229 1:237358023-237358045 GTTTGAAATTCTACTGTTACAGG + Intronic
1073247320 10:102100552-102100574 GTTATTCATTCTCCTGTCACTGG - Intergenic
1074740050 10:116477818-116477840 AGGAGTAATTCTCCTGTGGCAGG - Exonic
1075704747 10:124493796-124493818 CGACGTATTTCTCCTGTTACTGG - Intronic
1076276348 10:129202367-129202389 CATACTAATTCTCTTGTTACAGG - Intergenic
1079684341 11:23338518-23338540 GGTAGTGATTATCTTGTTAAAGG - Intergenic
1079715951 11:23745020-23745042 GATAGAAAATCTCCTGTAACTGG - Intergenic
1081446301 11:43134447-43134469 GTTTTTAAGTCTCCTGTTACAGG - Intergenic
1085073295 11:73568298-73568320 GGTAGTAATTTACATATTACAGG - Intronic
1089308291 11:117540880-117540902 GGTAGTGAGTCTCCTGTCACTGG + Intronic
1113423771 13:110190711-110190733 GTTAGTAATTTTCCTTTTATTGG - Intronic
1115525750 14:34279038-34279060 AGTCATAATTCTTCTGTTACTGG - Intronic
1116561875 14:46390119-46390141 GGTTGTAGTTCTCTTTTTACTGG + Intergenic
1117756899 14:58984204-58984226 GGTAGTTATTGTCAGGTTACGGG - Intergenic
1119927190 14:78506213-78506235 TGTAGTATTTGTCCTGTGACTGG + Intronic
1127480814 15:59375381-59375403 GGTAGTGTTTCTTGTGTTACTGG - Intronic
1128396787 15:67234449-67234471 TGTATTAATTTTCCTCTTACTGG - Intronic
1128675845 15:69607862-69607884 GGTAATAGCTCTCCTGCTACTGG - Intergenic
1130815056 15:87422553-87422575 GGTAGTAAGTTTCGTGTCACTGG + Intergenic
1131239196 15:90723895-90723917 TGTAGTATTTGTCCTGTGACTGG + Intronic
1139153522 16:64413476-64413498 GGTACTAATTCACCTTTTACAGG + Intergenic
1139324234 16:66139631-66139653 GGTAGTGAGTTTCCTGTCACTGG - Intergenic
1139336126 16:66232538-66232560 GGTAGTGAGTTTCCTGTCACTGG + Intergenic
1146532618 17:33622655-33622677 GGTAGATATTCTCATGTTATAGG + Intronic
1147416076 17:40290959-40290981 GGTAGAAATTCACCTCTTTCTGG + Intronic
1156737421 18:40277547-40277569 GGTAGCAATACTTCTGTAACGGG + Intergenic
1157041038 18:44039260-44039282 GGTAGTATCAATCCTGTTACTGG + Intergenic
1163016196 19:14456572-14456594 AATATTAATTCTCCTGTTAATGG + Intronic
1165289834 19:34874214-34874236 GGCGCTCATTCTCCTGTTACTGG + Intergenic
927967005 2:27276638-27276660 GGTAGTGAGTTTCCTGTCACTGG + Intronic
928083683 2:28332437-28332459 AGTAGAAATCATCCTGTTACAGG + Intronic
931626576 2:64261696-64261718 GGTTTTAATTATCTTGTTACTGG - Intergenic
933272844 2:80251763-80251785 GGTAGTACTTCTCAGGTAACTGG - Intronic
938014286 2:127854806-127854828 TGTAGTAAATCCCCTGTTATAGG - Intronic
938594557 2:132774694-132774716 GCTATTACTTCTCCTGCTACTGG - Intronic
938889307 2:135686858-135686880 GGCAGTATTTGTCCTGTGACTGG - Intronic
939907950 2:147941511-147941533 TGTAGTATTTCTCTGGTTACTGG + Intronic
940730483 2:157384599-157384621 GGTTGTAATTCTCCTGGAAGAGG - Intergenic
942062291 2:172239012-172239034 GGTATTAACTCTCCTTCTACAGG - Intergenic
1169776270 20:9257167-9257189 GGTAGTATTTATTCTGTTTCTGG + Intronic
1177409490 21:20711258-20711280 GGAAGTAACTCAGCTGTTACAGG - Intergenic
1181263913 22:21619031-21619053 GGTAGTAATTCTCCTGTTACAGG + Intronic
1182163030 22:28142651-28142673 TGTAATAAAACTCCTGTTACTGG + Intronic
952820773 3:37483796-37483818 TGTTGTCATTCTCCTGTGACAGG + Intronic
955222620 3:57035885-57035907 GGTAGTAATTCTAAGGTGACAGG - Intronic
957115648 3:76021477-76021499 GGACGTAATTCTACTGATACAGG - Intronic
957971396 3:87387672-87387694 AGATGAAATTCTCCTGTTACAGG - Intergenic
960233187 3:115253129-115253151 GGTAGCAAATCTCAAGTTACTGG - Intergenic
964460358 3:156918425-156918447 GGCTGTTATTCTCCTGTTCCTGG + Intronic
967765319 3:193272583-193272605 TGTAGTAATTCCCCTGCTTCGGG - Intronic
968590023 4:1453233-1453255 GGTAGTAATGCTGGTGTTGCTGG - Intergenic
969433789 4:7172267-7172289 AGTAGTCTTTCTCCTGTTACTGG + Intergenic
975579469 4:75893611-75893633 GGTAGAGATTCTGATGTTACAGG - Intronic
975735031 4:77372730-77372752 GATAGTAATTCCCCTCCTACTGG + Intronic
977170812 4:93760050-93760072 ATTACTAATTCTCCTTTTACAGG - Intronic
977435070 4:96984543-96984565 GGCAGGAATTCTCCTTTTTCAGG + Intergenic
988066685 5:26233982-26234004 GCTAGTAACTCTCCTGTCACTGG + Intergenic
988779329 5:34505232-34505254 GGGAGTAATTATCCTGTCTCTGG + Intergenic
991142341 5:63259333-63259355 GGCATTAATTCTACTGATACAGG - Intergenic
993915127 5:93735155-93735177 GGTAGTTATTCTTCTGTTTAAGG + Intronic
995878174 5:116814021-116814043 TGAAGTAATTTCCCTGTTACTGG + Intergenic
1006484238 6:34325070-34325092 GGTATTGAATCTCCTGTTTCTGG - Intronic
1011589353 6:88956460-88956482 GGTAGCAATTCTTCTTTGACTGG - Intronic
1018202133 6:161404967-161404989 GGGACTAATTCTTCTCTTACTGG + Intronic
1030953637 7:115823407-115823429 GGTAGTAATGCTCCTATTATTGG - Intergenic
1031333109 7:120491004-120491026 GGTAGTAGTTCTTCAGTCACTGG - Intronic
1031413310 7:121466295-121466317 GGTAGTAAGTCTCCTATTTCAGG + Intergenic
1031413639 7:121469659-121469681 AGTAGTAAGTCTCCTATTTCAGG + Intergenic
1032981772 7:137292335-137292357 TGTAGTAATTCCCATGTCACGGG + Intronic
1042666846 8:71216342-71216364 GGTTGTAAATCTCCTCCTACAGG - Intronic
1043395158 8:79828424-79828446 GGTAGAAATCCTCCTCTTGCAGG - Intergenic
1046188132 8:110749640-110749662 GGTATTTGTTCTCCTGTGACTGG - Intergenic
1046806590 8:118486082-118486104 TGAAGAAATTCTCTTGTTACTGG + Intronic
1048734212 8:137480445-137480467 GTTAGTTTTTCTTCTGTTACTGG + Intergenic
1051461004 9:17315447-17315469 GGTAGTGTTTCTCCTTTTCCTGG + Intronic
1054803304 9:69374486-69374508 GGTAGAAATTCACCAGTCACTGG - Intronic
1057350262 9:94290942-94290964 GGTAGTAGTTATCCTGTTTGTGG + Intronic
1057938722 9:99262020-99262042 GGTGGTAATTCTGATGCTACTGG - Intergenic
1058259255 9:102809660-102809682 GGTAGCACTTGGCCTGTTACTGG - Intergenic
1060813465 9:126622934-126622956 GGTAGTAATTCCAATCTTACAGG + Intronic