ID: 1181267769

View in Genome Browser
Species Human (GRCh38)
Location 22:21641060-21641082
Sequence TTGGTAGTCCCTGCACTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 723
Summary {0: 1, 1: 0, 2: 17, 3: 258, 4: 447}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181267769_1181267775 8 Left 1181267769 22:21641060-21641082 CCCTCAAGTGCAGGGACTACCAA 0: 1
1: 0
2: 17
3: 258
4: 447
Right 1181267775 22:21641091-21641113 CAGACTGACTTTTAACCGTTTGG 0: 1
1: 0
2: 0
3: 4
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181267769 Original CRISPR TTGGTAGTCCCTGCACTTGA GGG (reversed) Intergenic
900692112 1:3987260-3987282 CTGGGTCTCCCTGCACTTGAGGG + Intergenic
900812378 1:4816723-4816745 TTTTCAGACCCTGCACTTGATGG + Intergenic
900848917 1:5126602-5126624 TTTGCAGACTCTGCACTTGATGG + Intergenic
901412992 1:9098065-9098087 TTTGCAGGCCCTGCACTTGATGG + Intergenic
901479263 1:9513314-9513336 TTTGCAGACTCTGCACTTGATGG + Intergenic
902637797 1:17746334-17746356 TTTGCAGAACCTGCACTTGATGG + Intergenic
903039691 1:20519811-20519833 TTTGCAGACCTTGCACTTGATGG - Intergenic
903514264 1:23900089-23900111 TTTGCAGACCCTGCACTTGATGG + Intronic
904112491 1:28137101-28137123 TTTGCAGACCCTGCACTTTATGG - Intergenic
904303361 1:29570570-29570592 TTTGCAGACCCTGCACTTGATGG - Intergenic
904374980 1:30075091-30075113 TTTGCAGACCCTGCACTTGATGG + Intergenic
904733603 1:32613392-32613414 TTTGCAGACCCTGCACTTGATGG + Intronic
905054006 1:35077570-35077592 TTTGCAGACCCTGCACTTGATGG + Intronic
905475564 1:38224764-38224786 TTTGCAGACCCTGCACTTGATGG - Intergenic
905591245 1:39166001-39166023 TTGATAGTCCCTGTCTTTGAGGG + Intronic
906486400 1:46238686-46238708 TTTGCAGGCCCTGCACTGGATGG - Intergenic
907036688 1:51222358-51222380 TTTGCACACCCTGCACTTGATGG + Intergenic
907120957 1:52007512-52007534 TTTGCAGACCCTGCACTTGATGG - Intergenic
907510101 1:54951480-54951502 TTTGCAGACCCTGCACTCGATGG - Intergenic
908241538 1:62193057-62193079 TTTGCAGATCCTGCACTTGACGG - Intergenic
908246934 1:62234796-62234818 TTTGCAGACCCTGCACTTGATGG + Intergenic
909240216 1:73203397-73203419 CTGGTAATCCCAGCACTTGGTGG - Intergenic
910794453 1:91084215-91084237 TTTGCAGACCCTGCACTTGATGG + Intergenic
910795159 1:91090646-91090668 TTTGCAGACCCTGCACTTGATGG + Intergenic
910796565 1:91103177-91103199 TTTGCAGACCCTGCACTTGATGG - Intergenic
912346681 1:108969424-108969446 TTCCCAGACCCTGCACTTGATGG + Intergenic
912461850 1:109839422-109839444 TTTGCAGACCCTGCACTTAATGG + Intergenic
912537211 1:110383573-110383595 TTTGCAGGCCCTGCATTTGATGG - Intronic
913289903 1:117262335-117262357 TTTACAGACCCTGCACTTGATGG - Intergenic
915210828 1:154307961-154307983 TTTGCAGACTCTGCACTTGATGG + Intergenic
916124274 1:161555427-161555449 TTTGCAGACCCTGCACTTGATGG - Intergenic
916134155 1:161636786-161636808 TTTGCAGACCCTGCACTTGATGG - Intronic
916403392 1:164472713-164472735 TTGATAATCCCTACACTTTAAGG + Intergenic
916918460 1:169437239-169437261 TTTGCAGACCCTGCACTTGATGG - Intronic
916961717 1:169895722-169895744 TTTGCAGACCCTGCACTTGATGG + Intergenic
917557269 1:176102780-176102802 TTTGCAGACCCTGCACTTGATGG + Intronic
918307262 1:183258715-183258737 TTTGTAGACCCTGCACTTGATGG + Intronic
920244420 1:204577007-204577029 TTTGCAGACCCTGCACTCGATGG - Intergenic
921022604 1:211249893-211249915 TTTGCAGACCCTGCACTGGATGG - Intergenic
921883065 1:220275890-220275912 TTTGTAGACCCTGCACTTGATGG + Intergenic
922389109 1:225120310-225120332 TTTGCTGGCCCTGCACTTGATGG - Intronic
923140131 1:231154831-231154853 TGGGTAGTCCCAGCTCTTTAAGG + Intergenic
923779806 1:237012070-237012092 TAGGTAGTTCCTGTCCTTGATGG + Intergenic
923958901 1:239055033-239055055 TTTGAAGATCCTGCACTTGATGG + Intergenic
923975794 1:239260882-239260904 TTGGTAATCCCAGCACTTTGGGG - Intergenic
924483723 1:244460333-244460355 TTTACAGACCCTGCACTTGATGG + Intronic
924809058 1:247385019-247385041 TTTGTAGACCCTGCACTTGATGG - Intergenic
1063038817 10:2316238-2316260 TTTACAGACCCTGCACTTGATGG + Intergenic
1063236946 10:4126981-4127003 TTTGCAGCCCCTGCACTTGATGG - Intergenic
1063302787 10:4866907-4866929 TTTGCAGATCCTGCACTTGATGG - Intergenic
1063482767 10:6390961-6390983 TTTGCAGACCCTGCACTTGATGG + Intergenic
1063483276 10:6395475-6395497 TTTGCAGATCCTGCACTTGATGG - Intergenic
1064174520 10:13062847-13062869 TTTGCATGCCCTGCACTTGATGG + Intronic
1065217030 10:23459171-23459193 TTTGCAGACCCTGCACTTGATGG + Intergenic
1065679561 10:28214964-28214986 TTTGTAGACCCTGCACTCGATGG + Intronic
1065908217 10:30278550-30278572 TTTGCAGACCCTGCACTTGTTGG + Intergenic
1065952075 10:30661287-30661309 TTGGTAATCCCAGCACTTTGTGG - Intergenic
1066260851 10:33728462-33728484 TTTGCAGACCCTGCACTTGATGG + Intergenic
1067399904 10:45962138-45962160 TTTGCAGACCCTGCACTTGATGG + Intergenic
1067868233 10:49931437-49931459 TTTGCAGACCCTGCACTTGATGG + Intronic
1068111769 10:52688894-52688916 TTTGCAGATCCTGCACTTGATGG + Intergenic
1068164505 10:53311414-53311436 TTGGTAGTGCCTTCACTCAAGGG + Intergenic
1068985494 10:63104372-63104394 TTTGCAGACCCTGCACTTGATGG - Intergenic
1068985746 10:63106297-63106319 TTCGCAGACCCCGCACTTGATGG + Intergenic
1069196728 10:65560289-65560311 TTTGCAGACCCTGCACTTGATGG - Intergenic
1069504664 10:68987088-68987110 TTGGTAATCCCAGCACTTTAGGG + Intergenic
1069542269 10:69304033-69304055 TTTGCAGACCTTGCACTTGATGG - Intronic
1069869281 10:71523392-71523414 TTGGTAGTCCCCGAGTTTGAGGG - Intronic
1069936483 10:71921005-71921027 GTTGTAGACCCTGCACTTGATGG - Intergenic
1071275553 10:84051235-84051257 TTTGCAGACCCTGCACTGGATGG + Intergenic
1071357588 10:84813234-84813256 TTTGCAGACCCTGCACTTGATGG - Intergenic
1071551479 10:86569436-86569458 TTTGCAGACCCTGCACTTGATGG - Intergenic
1072248029 10:93560193-93560215 TTTGCAGACCCTGCACTCGATGG - Intergenic
1072253361 10:93599486-93599508 TTAGGAGTCCCTGCAGTTCAGGG + Intronic
1072970436 10:100012479-100012501 TTTGCAGACCCTGCAGTTGATGG - Intergenic
1076099711 10:127766356-127766378 TTTGCAGACCCTGCACTTGATGG - Intergenic
1077062587 11:624413-624435 TTGGTGGTGCCTGCCCTAGAAGG - Intronic
1077286696 11:1769432-1769454 TTTGCAGACCTTGCACTTGACGG + Intergenic
1077720628 11:4625101-4625123 TTTGTAAACCCTGCTCTTGATGG + Intergenic
1077927247 11:6694036-6694058 TTTACAGTCTCTGCACTTGATGG + Intergenic
1078385620 11:10889539-10889561 TTTGCAGACCCTGCACATGATGG - Intergenic
1078410041 11:11107165-11107187 TTTGCAGACTCTGCACTTGATGG + Intergenic
1078751168 11:14164933-14164955 TTTGCAGACCATGCACTTGATGG - Intronic
1078752446 11:14177514-14177536 TTTGCAGACCCTGCACTTGATGG - Intronic
1079061623 11:17253588-17253610 TTTGCAGACCCTGCACTTGATGG - Intronic
1079222578 11:18576653-18576675 TTTGCAGGCCCTACACTTGATGG + Intronic
1080880618 11:36316640-36316662 TTTGCAGACCCTGCACTGGATGG - Intronic
1080990886 11:37533337-37533359 TTTGTAGACCCTGCACTCAATGG - Intergenic
1081316707 11:41638884-41638906 TTTGCAGACACTGCACTTGATGG + Intergenic
1081972521 11:47209697-47209719 TTTGCAGACCCTGCACTTGATGG + Intergenic
1082867485 11:57913047-57913069 TTTGCAGACCCTGCACTTGACGG - Intergenic
1083013368 11:59425359-59425381 TTTGCAGACCCTGCACTAGATGG - Intergenic
1083107203 11:60369684-60369706 TTTGCAGACCCTGCAATTGATGG + Intronic
1083505996 11:63157842-63157864 TTTGCAGACACTGCACTTGATGG + Intronic
1084181232 11:67447460-67447482 TTTGCAGACCCTGCCCTTGATGG + Intergenic
1085058563 11:73423743-73423765 TTGGAAGCACCTGTACTTGATGG + Intronic
1085318916 11:75562553-75562575 TTGGGAGTCCGTGCACTCGGAGG + Exonic
1085416739 11:76323512-76323534 TTCACAGGCCCTGCACTTGATGG + Intergenic
1085579543 11:77638343-77638365 GTTGCAGACCCTGCACTTGATGG + Intergenic
1085580380 11:77644845-77644867 TTTGCAGCCCCTGCACTTGATGG - Intergenic
1086058886 11:82680430-82680452 TTTGTAAACCCTGCCCTTGATGG + Intergenic
1086832880 11:91587214-91587236 TTTGCAGACCCTGCACTTGATGG + Intergenic
1087050501 11:93882104-93882126 TTTGCAGACCCTGCACTTGATGG + Intergenic
1087431890 11:98065839-98065861 TTTGCAGACCCTGCACTCGATGG + Intergenic
1087715345 11:101602333-101602355 TTTGCAGACCCTGCACTCGATGG + Intronic
1087797863 11:102473254-102473276 TTTGCAGACCCTGCACTTGATGG - Intronic
1087870631 11:103289015-103289037 TTTGCAGACCCTGCACTAGATGG + Intronic
1087887055 11:103493686-103493708 TTTGCAGACCCTGCACTTCATGG + Intergenic
1087971931 11:104494759-104494781 TTTGCAGACCCTGCACTTGATGG + Intergenic
1088221729 11:107577114-107577136 TTTGCAGACCCTGCACTTGACGG + Intergenic
1088242399 11:107785771-107785793 TTTGCAGACCCTGCACTTGATGG - Intergenic
1088253351 11:107880609-107880631 TTTGCAGACCCTGCACTTGATGG + Intronic
1089389732 11:118092519-118092541 TTTGCAGACCCTGCACCTGACGG - Intronic
1090291746 11:125552058-125552080 TTTGTAAACCCTGCCCTTGATGG + Intergenic
1092879394 12:12876176-12876198 TCTGCAGACCCTGCACTTGATGG + Intergenic
1093181817 12:15975387-15975409 TTTGCAGACCCTGCACTTGATGG - Intronic
1094212166 12:27904171-27904193 TTTGCAGACCCTGCACTGGATGG - Intergenic
1094430980 12:30368816-30368838 TTTGCAGACCCTGCACTTGATGG - Intergenic
1095215652 12:39544283-39544305 TTTGCAGACCCTGCACTTGATGG - Intergenic
1095267735 12:40180119-40180141 TTTGCAGTCCCTGCACTTGATGG + Intergenic
1095572787 12:43701528-43701550 TTTGTAAACCCTGCCCTTGATGG - Intergenic
1096139268 12:49229085-49229107 TTGGTCTTCCCTGGACATGAAGG + Intronic
1096353434 12:50918809-50918831 TTTGCAGACCCTGCACTTGATGG - Intergenic
1096815506 12:54199366-54199388 ATGGTGGTCCTTGCCCTTGAAGG - Intergenic
1096939644 12:55328139-55328161 TTTGCAGACCCTGCACTTGATGG + Intergenic
1097757103 12:63418687-63418709 TTGGCTTTCCCTGCACTTCAAGG + Intergenic
1098282753 12:68878431-68878453 TTTTTAGACCCTGCACTGGATGG + Intronic
1098295423 12:68999361-68999383 TTTGCAGGCCCTGCATTTGATGG + Intergenic
1098765706 12:74486233-74486255 TTTGCAGACCCTGCACTTGACGG + Intergenic
1098864683 12:75748314-75748336 TTTGCAGACCCTGCACTTGACGG + Intergenic
1099112178 12:78575224-78575246 TTTGCAGACCCTGCAGTTGATGG + Intergenic
1099120974 12:78688886-78688908 TTTGCAGACTCTGCACTTGATGG + Intergenic
1099425940 12:82522769-82522791 CTGGCAGACCATGCACTTGAGGG + Intergenic
1100223588 12:92533523-92533545 TTCGCAGACCCTGCACTTGATGG - Intergenic
1100293516 12:93238751-93238773 TTTGTAGGCCCTGCACTTGATGG - Intergenic
1100647633 12:96547907-96547929 TTGTTAGTCCCTTCTCTTAAAGG - Exonic
1101148812 12:101866225-101866247 TTTGCAGACCCTGCACTTGATGG - Intergenic
1101383594 12:104235970-104235992 TTTGTAAACCCTGCCCTTGATGG - Intronic
1102075381 12:110055852-110055874 TTTGCAGACCCTGCACTTGATGG - Intronic
1102235093 12:111289526-111289548 TTCTTAGTCCCTGCCCTAGATGG + Intronic
1102740733 12:115205398-115205420 TTTGCAGACCCTGCACTTGATGG + Intergenic
1103093937 12:118118009-118118031 TTTTCAGACCCTGCACTTGATGG + Intronic
1103107156 12:118238995-118239017 TTGGTAGTACCTGCCCTGGATGG + Intronic
1103539664 12:121657342-121657364 TTTGCAGACCTTGCACTTGATGG + Intronic
1104320387 12:127745297-127745319 TTTGTAGACCCTGAACTTGATGG - Intergenic
1104349393 12:128031739-128031761 TTTGCAGACCCCGCACTTGATGG + Intergenic
1104355602 12:128082528-128082550 TTTGCAGACTCTGCACTTGATGG + Intergenic
1104784760 12:131442468-131442490 TTTGCAGGCCCTGCACTGGATGG + Intergenic
1104852760 12:131885368-131885390 TTTGCAGACCCTGCACTTGATGG - Intergenic
1105250658 13:18696616-18696638 TTTGCAGCCCCGGCACTTGATGG - Intergenic
1106005935 13:25770310-25770332 TTTGCAGACCCTGCACTTGATGG + Intronic
1106459984 13:29960114-29960136 TTTGCAGACCCTGCACCTGATGG - Intergenic
1106542321 13:30700981-30701003 TTTGTAGACCCTGCTCTGGATGG + Intergenic
1106756259 13:32826023-32826045 TTTGCAGACCCTGCACTTGATGG + Intergenic
1106798680 13:33233610-33233632 TTCTGAGTACCTGCACTTGATGG - Intronic
1107552831 13:41493236-41493258 TCAGTAGACCCTGAACTTGAAGG - Intergenic
1107664544 13:42675265-42675287 TTTGCAGATCCTGCACTTGATGG - Intergenic
1107698734 13:43025426-43025448 TTAGTAGTCCAGGTACTTGAAGG + Intronic
1107868649 13:44727690-44727712 TTTGCAGACCCTGCACTTGATGG + Intergenic
1108805311 13:54147885-54147907 TTTGCAGACCCTGCACTTGATGG - Intergenic
1109056979 13:57563228-57563250 TTTGCACACCCTGCACTTGAGGG - Intergenic
1109300334 13:60584376-60584398 TTTGCAGACCCTGCACTTGATGG + Intergenic
1110953213 13:81520794-81520816 TTTGTAAACCCTGCCCTTGATGG + Intergenic
1110977979 13:81864450-81864472 TTTGCAGACCCTGTACTTGATGG + Intergenic
1111125166 13:83905986-83906008 TTTGCAGACCCTGCACTTGATGG - Intergenic
1111190087 13:84795606-84795628 TTCGCAGACCCTGCACTTGATGG + Intergenic
1111256550 13:85677090-85677112 GTTGCAGGCCCTGCACTTGATGG - Intergenic
1111476945 13:88762065-88762087 TTTGCAGACCCTGTACTTGATGG + Intergenic
1112019284 13:95357733-95357755 TTTGCAGACCCTGCACTTGATGG - Intergenic
1112332234 13:98485443-98485465 TTTGCAGGCCCTGCACTTGATGG - Intronic
1112375991 13:98841452-98841474 TTGGTATTTCTTGCAATTGATGG - Intronic
1112592520 13:100776699-100776721 TTTGCAGACCCTGCACTTGATGG + Intergenic
1113466577 13:110517668-110517690 TCGAGAGTCCCTGCACCTGAGGG + Intergenic
1113701109 13:112388965-112388987 TTTGCAGAACCTGCACTTGATGG - Intronic
1113783609 13:112990197-112990219 GTGGTAGTTCCTGCACTTTCAGG - Intronic
1114235731 14:20821990-20822012 TTTGCTGACCCTGCACTTGATGG - Intergenic
1114422258 14:22594196-22594218 TTGGTGACCCCTGCACTTGATGG - Intergenic
1114446664 14:22793914-22793936 TTTGTAGACCCTGCTCTTGGTGG + Intronic
1114950826 14:27751492-27751514 TTGGTATTCTCTGCACTTCTTGG - Intergenic
1114977812 14:28123682-28123704 TTTGCAGACCCTGCACTGGATGG + Intergenic
1115168975 14:30481513-30481535 TTTGCAGCCCCTGCACTTGATGG + Intergenic
1115349053 14:32373452-32373474 TTTGCAGCCCCTGCACTTGATGG - Intronic
1115534271 14:34357918-34357940 TTTGCAGACCCTGCACTCGATGG - Intronic
1115893522 14:38059116-38059138 TTTGCAGATCCTGCACTTGATGG + Intergenic
1116119174 14:40699972-40699994 TTTGTAGACCCCGCACTTGGTGG + Intergenic
1116585420 14:46697287-46697309 TTTGCAGACCCTGCACTGGATGG + Intergenic
1117632459 14:57708148-57708170 TTTGCAGACCCTGCACTTGATGG + Intronic
1117818006 14:59618320-59618342 TTTGCAGACCCTGCACTTGATGG + Intronic
1118088231 14:62442996-62443018 TTGGCCGACCCTGAACTTGATGG + Intergenic
1118273507 14:64364998-64365020 TTTGCAGACCCTGCATTTGATGG + Intergenic
1118379799 14:65208325-65208347 TTTGTAGACTCTGCACTTGATGG - Intergenic
1118643853 14:67818643-67818665 TTTGTAGACCCTGCACTCCATGG + Intergenic
1118941534 14:70344116-70344138 TTTGCAGACCCTGCACTGGATGG - Intronic
1119028728 14:71174975-71174997 TTTGCAGACCCTGCACTGGATGG + Intergenic
1119823782 14:77640857-77640879 TTTGCAGACCCTGCGCTTGATGG + Intergenic
1120056465 14:79930035-79930057 TTTGCGGACCCTGCACTTGATGG + Intergenic
1120111748 14:80565194-80565216 TTTGCAGACCCTGCACTGGATGG + Intronic
1120225491 14:81786904-81786926 TTTGCAGACCCTGCACTGGATGG + Intergenic
1120694807 14:87632872-87632894 TTTGTAGACCCTGCACTTGATGG + Intergenic
1120828732 14:88978884-88978906 TTGCTAGTCTTTGAACTTGAAGG + Intergenic
1120970608 14:90203972-90203994 TTTGCAGATCCTGCACTTGATGG - Intergenic
1121514838 14:94542704-94542726 TTGGTAGTCCCTGACCTTCAGGG - Intergenic
1123478297 15:20608358-20608380 TTTGCAGACCCTGCACTCGATGG + Intergenic
1123842963 15:24268124-24268146 TTTGCAGCCCCTGCACTTGATGG + Intergenic
1123858000 15:24434196-24434218 TTTGCAGCCCCTGCACTTGATGG + Intergenic
1123862631 15:24484658-24484680 TTTGCAGCCCCTGCACTTGATGG + Intergenic
1124039867 15:26091447-26091469 TTTGCAGCCCCTGCACTTGATGG - Intergenic
1124603681 15:31154761-31154783 TTTGCAGAACCTGCACTTGATGG + Intronic
1125021838 15:34993700-34993722 TTTGTAGACCCTACACTTCATGG - Intergenic
1125029438 15:35061577-35061599 TTTGCAGACCCTACACTTGACGG + Intergenic
1125342518 15:38688937-38688959 TTTTCAGACCCTGCACTTGATGG + Intergenic
1125690693 15:41593800-41593822 TTTGCAGACCCTGCACTTCATGG - Intergenic
1126073098 15:44883025-44883047 TTTGCAGACCCTGCACTTGATGG - Intergenic
1126085164 15:45004614-45004636 TTTGCAGACCCTGCACTTGATGG + Intergenic
1127086141 15:55426200-55426222 TTTGCAGACCCTGCACTTGCTGG - Intronic
1127907003 15:63383203-63383225 TTTGCAGACCCTGCACTGGATGG - Intergenic
1128350961 15:66888142-66888164 TTTGCAGACCCTGCACTTGATGG - Intergenic
1128351790 15:66895638-66895660 TTTGCAGACCCTGCACTTGATGG - Intergenic
1128464943 15:67902630-67902652 TTTGCAGACCTTGCACTTGATGG + Intergenic
1128641180 15:69339005-69339027 TTTGCAGACCCTGCACTTGATGG + Intronic
1129138744 15:73577711-73577733 TTTGCAGACCTTGCACTTGATGG + Intronic
1129339650 15:74877078-74877100 TTTGCAGACCTTGCACTTGATGG + Intergenic
1129377161 15:75141056-75141078 TTTGCAGACCCTGCACTGGATGG + Intergenic
1130837159 15:87662658-87662680 TTTGCAGACCCTGCACTAGATGG + Intergenic
1130837843 15:87669215-87669237 TTTGCAGGCCCTGCACTTGATGG + Intergenic
1130999667 15:88929771-88929793 TTTGCAGACCCTGCACTGGATGG + Intergenic
1131577932 15:93610941-93610963 TTTGCAGACCCTGCACTCGAAGG + Intergenic
1131914276 15:97247144-97247166 TTGGCAGAGCCTGCACTTGATGG - Intergenic
1132275977 15:100564312-100564334 TTTGTAGACCCTGCACTTGATGG + Intronic
1133212318 16:4270618-4270640 TTGGTAGGCCAAGGACTTGAAGG - Intronic
1133524331 16:6589521-6589543 TTTGCAGACTCTGCACTTGATGG - Intronic
1133645792 16:7763381-7763403 TTTCCAGACCCTGCACTTGATGG - Intergenic
1133694094 16:8244273-8244295 TTTGCAGACGCTGCACTTGATGG - Intergenic
1134504672 16:14795189-14795211 TTTGCAGACCCTGCACGTGACGG - Intronic
1134575901 16:15333720-15333742 TTTGCAGACCCTGCACGTGACGG + Intergenic
1134606258 16:15573582-15573604 TTTGCAGACCGTGCACTTGATGG - Intronic
1134726543 16:16422781-16422803 TTTGCAGACCCTGCACGTGACGG - Intergenic
1134940889 16:18289078-18289100 TTTGCAGACCCTGCACGTGACGG + Intergenic
1135188607 16:20336172-20336194 TTTGTAGACCCTGCACTTAATGG + Intronic
1135672736 16:24389102-24389124 TTTGCAGACCTTGCACTTGATGG + Intergenic
1135809796 16:25576749-25576771 TTTGCAGACCCTGCACTCGATGG - Intergenic
1135965725 16:27033382-27033404 TTTGCAGGCCCTGCACTTGATGG + Intergenic
1136351711 16:29713103-29713125 TTTGTAAACCCTGCCCTTGATGG - Intergenic
1136356534 16:29747988-29748010 TTTGCAGACCCTGCACTTGATGG + Intergenic
1136598667 16:31269228-31269250 TTTGCAGACCTTGCACTTGATGG - Intronic
1137240438 16:46651163-46651185 TTTGTAGACCCTGCACTCGATGG - Intergenic
1137263904 16:46853104-46853126 TTTGCAGACCCTGCACTTGATGG + Intergenic
1138544925 16:57711912-57711934 TTTGCAGGCCCTACACTTGATGG - Intronic
1138605239 16:58084503-58084525 TTTGCAGACTCTGCACTTGATGG + Intergenic
1138818827 16:60234040-60234062 TTGGCAGACCCTATACTTGATGG - Intergenic
1138825085 16:60309200-60309222 TTTGCAGACCCTGCACTTGATGG - Intergenic
1139094010 16:63683125-63683147 TGGGTAGTCCCCACAGTTGAAGG - Intergenic
1139146081 16:64327265-64327287 TTTGCAGACCCTCCACTTGATGG + Intergenic
1140848104 16:78908812-78908834 TTTGCAGACCCTGCAATTGATGG - Intronic
1141133632 16:81451682-81451704 TTGGTCTTCCCTGCAGCTGAAGG + Intronic
1141262753 16:82468647-82468669 TTTGCAGACCCTGCACTGGATGG - Intergenic
1141765612 16:86057171-86057193 TTGGTAGTATCTGCACTTCTAGG + Intergenic
1142507230 17:372235-372257 TTTGGAAACCCTGCACTTGATGG + Intronic
1143170496 17:4926958-4926980 TTTGCCGACCCTGCACTTGATGG - Intergenic
1143274287 17:5698731-5698753 TTTGCCGACCCTGCACTTGATGG + Intergenic
1143605478 17:7982458-7982480 TTTGCAGACCCTGCACTCGATGG - Intergenic
1143898758 17:10157250-10157272 TTGGCAGGCCTTGCACTTCAGGG - Intronic
1144551378 17:16244084-16244106 TTTGCAGACCCTGCACTTGATGG - Intronic
1144593142 17:16541774-16541796 TTTGTAAACCCTGCCCTTGATGG - Intergenic
1147282863 17:39377183-39377205 TTTGCAGACCCTGCACTTGATGG + Intronic
1147363846 17:39947524-39947546 TTTGCAGACCCTGCACTTGATGG + Intergenic
1147841669 17:43376167-43376189 TTTGCAGACCCTGCACTTGATGG - Intergenic
1148221811 17:45868283-45868305 TTTGCAGACCCTGCACTTGATGG + Intergenic
1148649862 17:49242405-49242427 TTTGCAGACCCTGCACTTGATGG - Intergenic
1148965817 17:51435210-51435232 TTTGCAGACCCTGCACTTGATGG + Intergenic
1150157543 17:62866778-62866800 TTGGTAGTCTCTGCCCATGCAGG + Intergenic
1150451574 17:65273263-65273285 TTTGCAGACCTTGCACTTGATGG + Intergenic
1151284251 17:73098549-73098571 TTTGCAGAACCTGCACTTGACGG + Intergenic
1151807105 17:76412583-76412605 TTGGTTGTCCCTGAGCTTGAAGG + Intronic
1151866025 17:76803537-76803559 TTTGCAGACCCTGCACTCGATGG + Intergenic
1153100956 18:1469034-1469056 TTTGCTGACCCTGCACTTGATGG + Intergenic
1154438189 18:14362310-14362332 TTTGCAGACCCGGCACTTGATGG + Intergenic
1155211902 18:23609215-23609237 TTTGCAGACCTTGCACTTGATGG + Intronic
1155565602 18:27131022-27131044 TTGGAAGTCTCTGTACATGATGG - Intronic
1155932229 18:31719854-31719876 TTTGCAGACCCTGCACTTGATGG - Intergenic
1156674140 18:39507383-39507405 TTTGCAGACCCTGCACTTGATGG + Intergenic
1156902817 18:42321239-42321261 TTTGCAGACCCTGCACTTGATGG + Intergenic
1156903328 18:42326490-42326512 TTCGCAGACCCTGCACTTGATGG - Intergenic
1158005649 18:52669238-52669260 TTTGCAGACTCTGCACTTGATGG - Intronic
1159121719 18:64178616-64178638 TTTGCAGACACTGCACTTGATGG + Intergenic
1159580504 18:70230118-70230140 TTTGCAGACCCTGCACTTGATGG - Intergenic
1159596185 18:70384791-70384813 TTTGCAGACACTGCACTTGATGG - Intergenic
1159946378 18:74447269-74447291 CTGGTAGTCCTGGCACTGGAAGG + Exonic
1160290828 18:77591443-77591465 TTTGCAGACCCTGCACTCGATGG - Intergenic
1161870643 19:6867161-6867183 TTTGCAAACCCTGCACTTGATGG - Intergenic
1162208173 19:9071489-9071511 TTTGCAGACCCTGCACTCGATGG + Intergenic
1163196741 19:15727126-15727148 TTTGCAGATCCTGCACTTGATGG - Intergenic
1166497970 19:43318436-43318458 TTGGCAGACCCTGCACTTGATGG - Intergenic
1166821420 19:45582729-45582751 TTCACAGACCCTGCACTTGATGG - Intronic
1167160782 19:47765999-47766021 TTGGGCGGCCCTGCATTTGATGG - Intergenic
1167389872 19:49187938-49187960 TTTGCAGACCCTGCACTGGATGG - Intronic
1167839171 19:52099872-52099894 TTTGCAGTCCCTGCACTTGATGG + Intergenic
1167843678 19:52142209-52142231 TTTGCATTCCCTGCACTTGATGG + Intergenic
1168709285 19:58489283-58489305 TTTGCAGACTCTGCACTTGATGG + Intronic
925204242 2:1992898-1992920 TTTGCAGACCCTGCACCTGATGG + Intronic
926250325 2:11152120-11152142 TTTGCAGCCCCTGCACTGGATGG - Intergenic
926905503 2:17801647-17801669 TTTGTAGACCCTGCACTTGATGG + Intergenic
928441096 2:31292793-31292815 TTTGCAGATCCTGCACTTGATGG - Intergenic
928672557 2:33617221-33617243 TTTTCAGACCCTGCACTTGATGG - Intergenic
928930881 2:36622714-36622736 TTGCCAGTCCCTGGACTGGAGGG + Intronic
929111947 2:38412371-38412393 TTTGCAGATCCTGCACTTGATGG + Intergenic
929120329 2:38478921-38478943 TTTGCAGACCCTGCACTTGATGG + Intergenic
929455385 2:42061359-42061381 TTGGTTGTCCCTGCTCCTGAGGG + Intergenic
929464896 2:42135551-42135573 TTGGTTGTCTCTTCCCTTGAGGG - Intergenic
930065855 2:47327033-47327055 TTTGTAGACCCTGCACTTGATGG - Intergenic
930167230 2:48214830-48214852 TTTGCAGACCCTGCACTTGATGG - Intergenic
930172567 2:48266696-48266718 TTTGCAGACCCTGCACTTGATGG + Intergenic
930755117 2:54965733-54965755 TTTGCAGACCGTGCACTTGATGG - Intronic
931463089 2:62464902-62464924 TTTGCAGACCCTGCCCTTGATGG - Intergenic
932908867 2:75784494-75784516 TTTGCATCCCCTGCACTTGATGG - Intergenic
933536586 2:83583162-83583184 TTTTTAGACCCTGCACTTGATGG - Intergenic
935162542 2:100541699-100541721 TCTGCAGACCCTGCACTTGATGG - Intergenic
935371508 2:102351776-102351798 GTGGTCCTCCCTCCACTTGATGG - Exonic
936417629 2:112331940-112331962 TTGCTAGTTCCTGCCCCTGAGGG - Exonic
936780637 2:116028811-116028833 TTTGCAGACTCTGCACTTGATGG + Intergenic
936891044 2:117370651-117370673 TTTGTAGACCCTGCACTCTATGG - Intergenic
937184817 2:120030372-120030394 TTTGCAGACCCTGCACTGGATGG + Intronic
937411327 2:121679132-121679154 TTTGCAGACCCTGCACTTGATGG + Intergenic
937492859 2:122388116-122388138 TTTGCAGATCCTGCACTTGATGG + Intergenic
938973421 2:136452795-136452817 TTTGCAGACCCTGCGCTTGATGG - Intergenic
939104698 2:137935645-137935667 TTTGCAGACCCTGCACTTGATGG - Intergenic
939134234 2:138274567-138274589 TTTGCAGACCCTGCACTTGATGG - Intergenic
939265391 2:139866051-139866073 TTTGCAGACCCTGCACTTGATGG - Intergenic
940110504 2:150147366-150147388 TTTGCAGACTCTGCACTTGATGG - Intergenic
940650030 2:156433352-156433374 TTTGCAGACCCTGCACTTGACGG + Intergenic
941960305 2:171246659-171246681 TTTGCAGACTCTGCACTTGATGG - Intergenic
942026209 2:171913110-171913132 TTTGCAAACCCTGCACTTGATGG - Intronic
942173594 2:173309947-173309969 TTTGCAGACCCTGTACTTGATGG - Intergenic
943758934 2:191587767-191587789 TTTGCAGACCCTGCACTTGAAGG + Intergenic
943862682 2:192888956-192888978 TTTGCAGACCCTGTACTTGATGG - Intergenic
944301385 2:198128596-198128618 TTTGCAGACCCTGCACTTGACGG - Intronic
944646921 2:201789288-201789310 TTTGCAGACCCTGCACTGGATGG - Intergenic
945203705 2:207310174-207310196 TTTGTATTCCCTGCACTGTAAGG + Intergenic
945392349 2:209279545-209279567 TGTGCAGACCCTGCACTTGATGG + Intergenic
945936683 2:215909523-215909545 TTTTCAGACCCTGCACTTGATGG + Intergenic
946187531 2:217989450-217989472 TTGGGAGGCCCTGCAATTGGTGG + Intronic
946215593 2:218181011-218181033 TTTGCAGACTCTGCACTTGATGG - Intergenic
946492037 2:220157919-220157941 TTTGTAGACCGTGCACTTGATGG - Intergenic
946570007 2:221014132-221014154 TTTACAGACCCTGCACTTGATGG + Intergenic
946829938 2:223718338-223718360 CTTGCAGACCCTGCACTTGATGG + Intergenic
946830126 2:223720204-223720226 TTTGCAGACCCTGCACTTGATGG - Intergenic
947045834 2:225982283-225982305 TATGAAGACCCTGCACTTGATGG - Intergenic
947105629 2:226664811-226664833 TTGGAAGTCTCTGCTTTTGAGGG + Intergenic
947160381 2:227208403-227208425 TTTGTAGACCCTGCACTCAATGG + Intronic
947519996 2:230838264-230838286 TTTGCAGACCCTGCACTTGATGG + Intergenic
947619631 2:231581391-231581413 CTTGCAGACCCTGCACTTGATGG + Intergenic
947688629 2:232113954-232113976 TTTGCAGACACTGCACTTGATGG + Intronic
947802721 2:232941227-232941249 TTTGCAGACCCAGCACTTGATGG - Intronic
947807941 2:232981519-232981541 TTTGCAGGCCCTGCACTGGATGG + Intronic
947889089 2:233600648-233600670 TTTGCAGACCCAGCACTTGATGG - Intergenic
947965114 2:234273899-234273921 TTTGCAGACCCAGCACTTGATGG + Intergenic
948006666 2:234615190-234615212 TTTGCAGACCTTGCACTTGATGG + Intergenic
948302405 2:236917595-236917617 TTTGCAGACCCTGCACTGGATGG - Intergenic
1168818278 20:755849-755871 TTTTCAGACCCTGCACTTGATGG + Intergenic
1169302467 20:4456145-4456167 TTTGTAGACCCTGTACTTGATGG + Intergenic
1169501500 20:6165107-6165129 TTGGAATTCACTGAACTTGAGGG + Intergenic
1170466054 20:16623371-16623393 TTTGCATACCCTGCACTTGATGG - Intergenic
1170966146 20:21073390-21073412 TTGGTAATCCCAGCACTTTGGGG - Intergenic
1171475517 20:25405791-25405813 TTTGTAGACCCTGCACTTGATGG - Intergenic
1172795783 20:37536394-37536416 TTTGCAGACCCTGCACTTGATGG + Intergenic
1173746961 20:45444902-45444924 TTTGCAGACCCTGCACTTGATGG - Intergenic
1174147407 20:48461542-48461564 TTTGCAGCCCCTGCACTTGATGG - Intergenic
1174537085 20:51259652-51259674 TTTGCAGACCCTGCACTGGATGG + Intergenic
1175028753 20:55931079-55931101 TTTGCAGACCCTGCACTTGATGG - Intergenic
1175198357 20:57261849-57261871 GTGGTAGGGCCTGCTCTTGACGG + Intronic
1176457487 21:6927162-6927184 TTTGCAGACCCGGCACTTGATGG - Intergenic
1176835660 21:13792246-13792268 TTTGCAGACCCGGCACTTGATGG - Intergenic
1177332490 21:19681429-19681451 TTTGTAAACCCTGCTCTTGATGG - Intergenic
1177549467 21:22601254-22601276 TTTTCAGACCCTGCACTTGATGG + Intergenic
1177737343 21:25108047-25108069 TTTCAAGACCCTGCACTTGATGG - Intergenic
1177782437 21:25635432-25635454 TTCGCAGACCCTGCACTTGATGG + Intergenic
1177801447 21:25832652-25832674 TTTGCAAACCCTGCACTTGATGG + Intergenic
1178602733 21:34008953-34008975 TTTGCAGACTCTGCACTTGATGG - Intergenic
1178785539 21:35649918-35649940 TTTGCAGACCCTGCACTTGATGG + Intronic
1179234826 21:39536339-39536361 TTTGCAGACCCTGCACTGGATGG - Intergenic
1179640223 21:42742853-42742875 TTTGGAGACCCTGCAGTTGATGG - Intronic
1179672857 21:42961897-42961919 TTTGCAGACCCTGCACTCGATGG - Intergenic
1180106212 21:45619781-45619803 TCTGCAGACCCTGCACTTGATGG - Intergenic
1181267769 22:21641060-21641082 TTGGTAGTCCCTGCACTTGAGGG - Intergenic
1181461351 22:23087820-23087842 ATTGCAGACCCTGCACTTGATGG - Intronic
1181503652 22:23335682-23335704 TTTGCAGACCCTGCACTTGATGG - Intergenic
1181640746 22:24196785-24196807 TTGGCAGTCCCTGCACTCCATGG + Intergenic
1181644102 22:24221367-24221389 TTTGCAGACCCTGCACTTGATGG + Intronic
1181654220 22:24282165-24282187 TTTGCAGACCCTGCACTTGATGG - Intronic
1181708649 22:24665916-24665938 TTTGCAGACCCTGCACTTGATGG - Intergenic
1182454519 22:30441385-30441407 TTTGCAGACCCTGCACTTGACGG - Intergenic
1182488222 22:30652282-30652304 TTTGCAGCCCCTGCCCTTGATGG - Intronic
1182500086 22:30740329-30740351 TTTGCAAACCCTGCACTTGATGG - Intronic
1182559684 22:31150035-31150057 TTTGCAGACCCTGCACTGGATGG + Intergenic
949999166 3:9642982-9643004 TTTGCAGACCCTGCACTTGATGG - Intergenic
950511799 3:13433724-13433746 TTTGCAGACCCTGCACTTAATGG + Intergenic
950780630 3:15388598-15388620 TCTGCAGACCCTGCACTTGATGG - Intronic
951113478 3:18833026-18833048 TTTGCAGACCCTGCACTCGATGG - Intergenic
952108556 3:30096338-30096360 TTTGCAGACCCTGCACTTGATGG - Intergenic
952297863 3:32076898-32076920 TTTGCAGACCCTGCACTTGATGG - Intronic
952801684 3:37298434-37298456 TTTGCAGACCCTGCACTTGATGG - Intronic
952928897 3:38344481-38344503 TTTAGAGACCCTGCACTTGATGG - Intergenic
953212105 3:40885134-40885156 TTTGCAGACCCTGCACTGGATGG - Intergenic
953612635 3:44460498-44460520 TTTGCAGACCCTGCACTTGATGG + Intronic
953613489 3:44468586-44468608 TTTGCAGCCCCTGCACTTGATGG + Intronic
953683079 3:45054066-45054088 TTTGCAGCCCCTGCACTTGATGG - Intergenic
955698409 3:61659133-61659155 TTGGTAATCCCTGCTTTTAAGGG + Intronic
956300776 3:67770358-67770380 TTTACAGACCCTGCACTTGATGG - Intergenic
956387327 3:68733978-68734000 TTTCCAGTCCCTGCACTAGAAGG - Intronic
956706670 3:72005078-72005100 TTTGTAGACCTTGCACTTGATGG + Intergenic
957461696 3:80530090-80530112 TTTGCACACCCTGCACTTGATGG + Intergenic
958151323 3:89697755-89697777 TTTGCAGAGCCTGCACTTGATGG - Intergenic
958573181 3:95912833-95912855 TTTGTGGACCCTGTACTTGATGG - Intergenic
958628294 3:96655233-96655255 TTTGCAGACCCTGCACTTAATGG + Intergenic
958968087 3:100581249-100581271 TTTGCAGACCCTGCAGTTGATGG - Intergenic
959161954 3:102734715-102734737 TTTGCAGACCCTGCACCTGATGG + Intergenic
959294503 3:104519031-104519053 TTTGCAGACCCTGCACTTGATGG + Intergenic
960001547 3:112736681-112736703 TTTGCAGACCCTGCACTTGATGG - Intergenic
960004690 3:112770144-112770166 TTTGCAGACCCTGCACTTGTTGG + Intronic
960006573 3:112787344-112787366 TTTGCAGACCCTGCACTTGATGG + Intronic
960609539 3:119542921-119542943 TTTGCAGCCCCTGCACTTGATGG + Intronic
962038849 3:131683607-131683629 TTGGTGGTGCATGCACCTGAGGG + Intronic
963085671 3:141434051-141434073 TTTGTACTCCCTGCACCTGTAGG - Intronic
963103908 3:141629319-141629341 TTTGCAGTCTCTGCACTTGATGG - Intergenic
963171657 3:142257262-142257284 TTTGCAGACCCTGCACTTGATGG - Intergenic
963314225 3:143742104-143742126 TTTGCAGACCCTGCACTTGATGG + Intronic
963993092 3:151676292-151676314 TTTGCAGACCCTGCACTTGATGG + Intergenic
964366233 3:155953509-155953531 TTTGCACACCCTGCACTTGATGG - Intergenic
964759811 3:160124100-160124122 TTTGCAGACCTTGCACTTGATGG - Intergenic
964921211 3:161897983-161898005 TTTGCAGACCCTGCACTTGATGG + Intergenic
965087990 3:164124368-164124390 TTTGCAGACCCTGCACTTGATGG - Intergenic
965142978 3:164863460-164863482 TTTGCAGAGCCTGCACTTGATGG + Intergenic
965840213 3:172896130-172896152 TTGGCAGACCCTGCACGTGATGG - Intronic
966271408 3:178111444-178111466 TTTGTAATCCCAGCACTTGGGGG + Intergenic
966533902 3:181009599-181009621 TTTGCAGACCCTGTACTTGATGG - Intergenic
966757407 3:183384465-183384487 TTTGCAAACCCTGCACTTGATGG + Intronic
966934873 3:184699575-184699597 TTTGCAGACCCTGCACTTGACGG - Intergenic
968146439 3:196303062-196303084 TTTGCAGACCCTGCACTTGATGG + Intronic
968151925 3:196343738-196343760 TTTGCAGACCCTGCACTTGATGG - Intergenic
968163252 3:196444160-196444182 TTTGCAGACTCTGCACTTGATGG - Intergenic
968290982 3:197539641-197539663 TTTGCAGACCCTGCACTGGATGG + Intronic
969664152 4:8547454-8547476 TTCGTAGACCCTGAACTTGATGG + Intergenic
969889200 4:10243929-10243951 TTTGCAGACCCTGTACTTGATGG - Intergenic
970132249 4:12884851-12884873 TTAGTAATGCCTGAACTTGATGG - Intergenic
970235090 4:13950654-13950676 TTTGCCGACCCTGCACTTGATGG + Intergenic
970442645 4:16095168-16095190 TTTGCGGACCCTGCACTTGATGG - Intergenic
970528975 4:16962845-16962867 TTTGTAGACCCTGTACTTGATGG - Intergenic
970579383 4:17460896-17460918 TTTGCAGACCCTGCACTTGACGG - Intronic
970723039 4:19010056-19010078 TTTGCAGGCCCTGCACTTGATGG - Intergenic
970797675 4:19933376-19933398 TTGGTAATTCCAGTACTTGAAGG + Intergenic
971349204 4:25841700-25841722 TTTGTAATCCCTGCACTTTGGGG + Intronic
971383961 4:26126232-26126254 TTGGTAGTCCCTGCCTCTTATGG + Intergenic
971623465 4:28887116-28887138 TTCGCAGACCCTGCACTTGATGG - Intergenic
972215925 4:36896699-36896721 TTGCTAAACCCTGCCCTTGATGG - Intergenic
972568630 4:40290964-40290986 TTTGCAGACTCTGCACTTGATGG + Intergenic
973252911 4:48079372-48079394 TTTGCAGACCCTGCACTTGATGG + Intronic
973581824 4:52351668-52351690 TTTGCAGACCCTGCACTTGACGG + Intergenic
974433964 4:61833610-61833632 TTTGCAGATCCTGCACTTGATGG - Intronic
975707182 4:77122762-77122784 TTTGCAGACCCTGCACTTGATGG + Intergenic
975916468 4:79331394-79331416 TTTGCAGACCCTGCACTTGGTGG - Intergenic
976255469 4:83095945-83095967 TTTGCAGACCCTGCGCTTGATGG - Intronic
976884042 4:89964321-89964343 GTTGCAGACCCTGCACTTGATGG - Intergenic
977073467 4:92422663-92422685 TTTGCAGACCTTGCACTTGATGG - Intronic
977527647 4:98164295-98164317 TTTGCAGACCCTGCACTTGATGG + Intergenic
977610423 4:99024595-99024617 TTTGCAGACTCTGCACTTGATGG - Intronic
978019441 4:103788926-103788948 TTTGTAAACCCTGCCCTTGATGG - Intergenic
978398571 4:108308041-108308063 TGTGGAGACCCTGCACTTGATGG - Intergenic
978557560 4:109997243-109997265 TCTGTAGACCCTGCACTTGATGG - Intronic
979484718 4:121257390-121257412 TTTGCAGACCCTGCACTTGATGG - Intergenic
979591296 4:122483374-122483396 TTTGCAGACTCTGCACTTGATGG - Intergenic
979719186 4:123879142-123879164 TTTGCAGACCCTGCACTGGATGG + Intergenic
980497086 4:133600103-133600125 TTTGCAGACCCTGCACTTGATGG + Intergenic
980626626 4:135381596-135381618 TTTGCAGACCCTGCACTTGATGG + Intergenic
980777207 4:137452597-137452619 TTTGCAGACTCTGCACTTGATGG - Intergenic
980777403 4:137454317-137454339 TTTGCAGACCCTGCACTTGATGG + Intergenic
980832868 4:138152747-138152769 TTTGCAGACTCTGCACTTGATGG - Intergenic
981688729 4:147482534-147482556 TTGGAAGAACCTGCAGTTGAGGG + Intronic
982008821 4:151087505-151087527 TTTGAAGACCCTGCTCTTGATGG + Intergenic
982500903 4:156153384-156153406 TTTACAGACCCTGCACTTGATGG - Intergenic
982659827 4:158193259-158193281 TTGGAAGCCCCTGCATTAGAGGG + Intergenic
982702969 4:158676335-158676357 TTTGCAGATCCTGCACTTGATGG - Intronic
982788201 4:159560170-159560192 TTTGCAGACTCTGCACTTGATGG - Intergenic
982904431 4:161049824-161049846 TTTGCAGACTCTGCACTTGACGG + Intergenic
984097873 4:175453765-175453787 TTTACAGACCCTGCACTTGATGG - Intergenic
984701923 4:182824072-182824094 TTTGCAGATCCTGCACTTGATGG + Intergenic
984879324 4:184396690-184396712 TCTGTAATCCCTGCACTGGAAGG - Intronic
985347567 4:189022760-189022782 TTTGCAGACCCTGCACTGGATGG + Intergenic
985758254 5:1731963-1731985 TTTGCAGACCTTGCACTTGATGG + Intergenic
986212202 5:5684526-5684548 TTTGCAGACTCTGCACTTGATGG - Intergenic
986463469 5:7996963-7996985 TTTGCAGACCCTGCACTCGATGG - Intergenic
987118692 5:14746497-14746519 TTTGCAGATCCTGCACTTGATGG - Intronic
987781048 5:22435765-22435787 TTTGCAGACCCTGCACTTGATGG + Intronic
988130445 5:27097101-27097123 TTTATGGACCCTGCACTTGATGG - Intronic
988419826 5:30992009-30992031 TTTGCAGACCCTGCACTAGATGG + Intergenic
988726128 5:33928179-33928201 TTTGCAGACCCTGTACTTGATGG - Intergenic
988783333 5:34543327-34543349 TTTGCAAACCCTGCACTTGATGG - Intergenic
988983194 5:36592027-36592049 TTTGCAGACTCTGCACTTGATGG - Intergenic
989010756 5:36869448-36869470 TCTGCAGACCCTGCACTTGATGG - Intergenic
989084552 5:37661759-37661781 TTTGCAGACCCTGCACTTGATGG - Intronic
989388919 5:40880439-40880461 TTTGCAGACCCTGCACTTGATGG - Intergenic
990237802 5:53786631-53786653 TTTGCAGACCCTGCACTTGATGG + Intergenic
991142028 5:63255624-63255646 TTTGGAGACCCTACACTTGATGG + Intergenic
991239898 5:64445592-64445614 TTTGCAGACCCTGCACTTGATGG + Intergenic
992107383 5:73461156-73461178 TTGGCAGACCCTGCACTTGATGG + Intergenic
992286644 5:75242291-75242313 TTTGCAGTCCCTGAGCTTGATGG - Intergenic
992781710 5:80133987-80134009 TTTGGAGACCCTGCACTCGATGG - Intronic
993272845 5:85817334-85817356 TTTGCAGACCCTGCACTGGATGG + Intergenic
993421968 5:87714036-87714058 TTTGCAGACCCTGCACTTGATGG - Intergenic
993422751 5:87721760-87721782 TTTGCAGACCCTGCACTTGATGG - Intergenic
993647936 5:90482653-90482675 TTTGCAGACCCTGCACTTGATGG + Intronic
994034632 5:95184775-95184797 TTTTCAGACCCTGCACTTGATGG + Intronic
995000077 5:107116741-107116763 TGGGGAGTGCCTGCACTTTAAGG + Intergenic
995200960 5:109424890-109424912 TTTGCAGACCCTGCACTTAATGG + Intergenic
995552137 5:113292488-113292510 TTTGTAGTCCCTGCATTGGCTGG - Intronic
995581626 5:113608366-113608388 TTGGCAAACCCTGCCCTTGATGG - Intergenic
996132272 5:119795954-119795976 TTTGCAGACTCTGCACTTGATGG - Intergenic
998995993 5:147869761-147869783 TTTGCAGACTCTGCACTTGATGG + Intergenic
999832246 5:155331780-155331802 TTTGCAGACCCTGCACTTGATGG - Intergenic
1001856029 5:175011821-175011843 TTGCTTGGCCCTGCACTGGATGG - Intergenic
1003223677 6:4185704-4185726 TTTGCAGACCCTGCACTTGATGG - Intergenic
1003255986 6:4475281-4475303 TTTCCAGACCCTGCACTTGATGG - Intergenic
1003267946 6:4583044-4583066 TTTGAAGACCCTGCACTTGATGG + Intergenic
1004257601 6:14079386-14079408 TTGGCAGACCCTGCACTTGATGG + Intergenic
1004359061 6:14954886-14954908 TTTGCAGACCCTGCACTTGATGG + Intergenic
1004368344 6:15030804-15030826 TTTGCAGATCCTGCACTTGATGG - Intergenic
1004390255 6:15203875-15203897 TTTGCAGACCCTGCACTTGATGG - Intergenic
1004468526 6:15907517-15907539 TTTGCAGACCCTGCACTTGATGG - Intergenic
1005119359 6:22372763-22372785 TTTGTAAACCCTGCCCTTGATGG - Intergenic
1005218822 6:23562813-23562835 TTTGCAGGCCCTGGACTTGATGG - Intergenic
1006329034 6:33376180-33376202 TTTGTCGACCCTGCACTTGATGG - Intergenic
1006554514 6:34853963-34853985 TTTGTAATCCCTGCACTTTGGGG + Intronic
1006681539 6:35800148-35800170 TTTGCTGACCCTGCACTTGATGG - Intergenic
1008047606 6:46867303-46867325 TGGGTTCTCCATGCACTTGAAGG + Intronic
1008607942 6:53158636-53158658 CCGGTAATCCCAGCACTTGAAGG + Intergenic
1008879148 6:56362992-56363014 TTGGTAGTGCCTGGCCCTGATGG - Intronic
1010201079 6:73282663-73282685 TTTACAGACCCTGCACTTGATGG + Intronic
1010574557 6:77514851-77514873 TTTGTAGACCCTGTAATTGATGG + Intergenic
1010843611 6:80678163-80678185 TTTGCAGACCCTGCATTTGATGG - Intergenic
1013089614 6:106888325-106888347 TTTGCAGGCCCTGCACATGATGG + Intergenic
1013761041 6:113518341-113518363 TTTGCAGCCCCTGCACTTGATGG + Intergenic
1013935614 6:115589588-115589610 TTTTCAGACCCTGCACTTGATGG + Intergenic
1014274310 6:119369425-119369447 TTTGCAGACCCTGCACCTGATGG - Intergenic
1015173239 6:130278108-130278130 TTTGCAGACCCTGCACTTTATGG + Intronic
1015311612 6:131773051-131773073 TTTGCAGACCCTGCACTTGATGG - Intergenic
1016521352 6:144950426-144950448 TTTGCAGACCCTGCACTTGATGG - Intergenic
1016742513 6:147542671-147542693 TTTGCAGACCCTGCCCTTGACGG - Intronic
1017177754 6:151520685-151520707 TTTGCAGACCCTGCACTTGATGG + Intronic
1017778607 6:157698970-157698992 TTTGCAGACCCTGCACTCGATGG - Intergenic
1017785558 6:157754073-157754095 TTTGCAGACCCTGCACTTGATGG - Intronic
1017795749 6:157842735-157842757 TTTGCAGACCCTGCACTTGATGG - Intronic
1017795944 6:157844458-157844480 TTTGCAGACTCTGCACTTGATGG - Intronic
1017921824 6:158879523-158879545 TTTGCAGACCCTGCACTTGATGG - Intronic
1017927116 6:158920330-158920352 TTTGCAGACCCTGCACTTGATGG + Intergenic
1018313230 6:162531619-162531641 TTTGCAGACCCTGCACTTGATGG - Intronic
1019803834 7:3108013-3108035 TTTGCAAACCCTGCACTTGATGG + Intergenic
1020070654 7:5224730-5224752 TTTGCAGACCCTGCACTTGATGG - Intronic
1020267282 7:6569487-6569509 TTTGCAGGCCCTGCACTGGATGG - Intergenic
1020763967 7:12298510-12298532 TTTGCAGACCCTGCACTTGATGG + Intergenic
1021507605 7:21402707-21402729 TTTGCAGACCCTGCACTTGATGG - Intergenic
1021897176 7:25248445-25248467 TTTGCAGACCCTGCACTGGACGG + Intergenic
1022208629 7:28186596-28186618 TTGGAGGCCTCTGCACTTGATGG + Intergenic
1023437088 7:40150184-40150206 TTTGCAGACCCTGCACTTGATGG + Intronic
1023753617 7:43395069-43395091 TTCATAGACCCTGCACTTGATGG - Intronic
1023800766 7:43832489-43832511 TTTGCAGACCCTGTACTTGATGG + Intergenic
1024315871 7:48016090-48016112 TTTGCAGACCCTGCACTAGATGG + Intronic
1026081576 7:67226401-67226423 TTTGCAGACCTTGCACTTGATGG + Intronic
1026084178 7:67249220-67249242 TTTGCAGACACTGCACTTGATGG - Intergenic
1026110849 7:67457970-67457992 TTTGCAGACCCTGCACTGGATGG + Intergenic
1026130969 7:67620724-67620746 TTTGTAGCCTCTGCACTGGATGG + Intergenic
1026142889 7:67721346-67721368 TTTGTAGAACCTGCACTGGATGG - Intergenic
1026205797 7:68256073-68256095 TTTGCAGACCTTGCACTTGATGG - Intergenic
1026228917 7:68466570-68466592 TTTTCAGACCCTGCACTTGATGG + Intergenic
1026287990 7:68980527-68980549 TTTACAGACCCTGCACTTGATGG + Intergenic
1026495177 7:70895582-70895604 TTTGCAGACCCTGCACTTGATGG - Intergenic
1026496391 7:70907349-70907371 TTTGCAGACCCTGCACTTGATGG + Intergenic
1026559368 7:71435532-71435554 TTTGCAGACCCTGCACTTGATGG + Intronic
1026692908 7:72565125-72565147 TTTGCAGACGCTGCACTTGATGG + Intronic
1026695500 7:72587596-72587618 TTTGCAGACCTTGCACTTGATGG - Intronic
1026799579 7:73391201-73391223 TCTGCAGACCCTGCACTTGATGG + Intergenic
1028146618 7:87327056-87327078 TCTGCAGACCCTGCACTTGATGG + Intergenic
1028229344 7:88287680-88287702 TTTGCAGACCCTGCACTGGATGG - Intronic
1028557315 7:92137826-92137848 TTTGCAGACCCTGCACTTGATGG - Intronic
1029509550 7:100985342-100985364 TTTGCAGACCCCGCACTTGATGG - Intronic
1029559495 7:101293152-101293174 TTTGCAGACCCTGCACTTGATGG + Intergenic
1030155578 7:106451111-106451133 TTTTCAGACCCTGCACTTGATGG - Intergenic
1030999740 7:116400852-116400874 TTGGCAGAACTTGCACTTGATGG - Intronic
1031702297 7:124941679-124941701 TTTGCAGACCCTGCACTTGATGG - Intergenic
1032247450 7:130225068-130225090 TTTGCAGCCCCTGCACTTGATGG + Intergenic
1032682077 7:134195160-134195182 TTTGTAGACCCTGCACTTGATGG - Intronic
1032710404 7:134455997-134456019 CTGGTAGTCTCTACTCTTGAAGG - Intronic
1033069659 7:138190716-138190738 TTTGCAGACCCTGCACTTGATGG + Intergenic
1033071541 7:138207874-138207896 TTTGCAGACCCTGCACTTAATGG - Intergenic
1033076920 7:138258375-138258397 TTTGCAGCTCCTGCACTTGATGG + Intergenic
1033340212 7:140486120-140486142 TTTGCAGACCCTGCACTTGATGG - Intergenic
1033365863 7:140672402-140672424 TTTGCAGACCCTGCACTTGATGG - Intronic
1034042752 7:147896662-147896684 TCTGCAGACCCTGCACTTGATGG - Intronic
1035435332 7:158855381-158855403 TTTGCAGAACCTGCACTTGATGG - Intergenic
1035811575 8:2495898-2495920 TTTGCAAACCCTGCACTTGATGG - Intergenic
1036047997 8:5165432-5165454 TTTGGAGACCCTGCACTTAATGG - Intergenic
1036162208 8:6399711-6399733 ATTGCAGACCCTGCACTTGATGG + Intergenic
1036466361 8:9001644-9001666 TTTGCAGGCCCTGCACTTGATGG - Intergenic
1036501315 8:9317042-9317064 CTGAGAGTCCCTGAACTTGAGGG + Intergenic
1037134290 8:15443809-15443831 TTTGCAGACCCTGCAGTTGATGG + Intronic
1038393626 8:27230075-27230097 TTTGCAGACCCTGCACTTGATGG + Intergenic
1038666591 8:29542932-29542954 TTTGCAGACCTTGCACTTGATGG + Intergenic
1038732220 8:30137944-30137966 TTTGTAGACCCTGCCCTTGATGG + Exonic
1039037577 8:33376479-33376501 TATATAGTCCCTTCACTTGAAGG - Intronic
1039183696 8:34893464-34893486 TTTGTAAGCCCTGCCCTTGATGG - Intergenic
1039301719 8:36216696-36216718 TTTGCAGACCCTGCACTTGATGG + Intergenic
1039694364 8:39894905-39894927 TTTGCAGACCCTGCGCTTGATGG - Intergenic
1039699314 8:39946128-39946150 TTTGCAGACCCTGTACTTGATGG + Intronic
1039959352 8:42233909-42233931 TTTGCAGACCCTGCACTTGATGG - Intergenic
1040526297 8:48228055-48228077 TTTGTAAACCCTGCCCTTGATGG - Intergenic
1040998058 8:53421689-53421711 TTTGCAGACCCTGCACTTGATGG + Intergenic
1041183500 8:55273568-55273590 TTTGCAGACCCTGCACTTGATGG + Intronic
1041240534 8:55845417-55845439 TTTGCAGACCCTGCACTTGATGG - Intergenic
1041758035 8:61335126-61335148 TTTGCAGACTCTGCACTTGATGG - Intronic
1041977790 8:63818992-63819014 TTTGCAGACCTTGCACTTGATGG - Intergenic
1042309817 8:67368924-67368946 TTTGCAGACCCTGCACTTGATGG + Intergenic
1043250706 8:78069666-78069688 TTGGCAGACCCTGCGCTTGATGG + Intergenic
1043266955 8:78278751-78278773 TTTGCAGACCCTGCACTTGATGG + Intergenic
1043668191 8:82844814-82844836 TTTGCAGACCCTGCACTTGATGG - Intergenic
1043740885 8:83810317-83810339 TTTGCAGACCCTGCACTTGAAGG + Intergenic
1044133874 8:88560193-88560215 TTTGCAGACCCTGTACTTGATGG + Intergenic
1044602143 8:94016069-94016091 ATAGTAGTTCCTGAACTTGAGGG - Intergenic
1045786014 8:105921463-105921485 TTTGCAGATCCTGCACTTGATGG + Intergenic
1045956975 8:107919572-107919594 TTTGCAGATCCTGCACTTGACGG + Intronic
1045994068 8:108342631-108342653 ATTGCAGACCCTGCACTTGATGG + Intronic
1047385039 8:124401277-124401299 TTTGCAGACCCTGTACTTGATGG + Intergenic
1047866438 8:129029076-129029098 TTTTTAGACCCTGCACTTGATGG - Intergenic
1048800831 8:138192544-138192566 TTTGCAGACCCTGCACTTGACGG + Intronic
1048908525 8:139111830-139111852 TTGGTAGTCCCTGATCTAGGAGG + Intergenic
1049741814 8:144244641-144244663 TTGGTGCTCTCTGCACTTGGGGG + Intronic
1050717054 9:8541623-8541645 CTGGTAATCCCAGCACTGGAAGG - Intronic
1051248606 9:15136760-15136782 TTTGCAGACCCAGCACTTGAAGG + Intergenic
1053054193 9:34984323-34984345 TTGGAAATCTCTGTACTTGATGG - Intergenic
1053074713 9:35122989-35123011 TTTGCAGACCCTGCACTTGATGG - Intergenic
1053203456 9:36167764-36167786 TTTGCAGAACCTGCACTTGATGG - Intergenic
1053597129 9:39574073-39574095 TTTGCAGACGCTGCACTTGATGG - Intergenic
1053855159 9:42331064-42331086 TTTGCAGACACTGCACTTGATGG - Intergenic
1054569128 9:66790924-66790946 TTTGCAGACGCTGCACTTGATGG + Intergenic
1054725173 9:68642679-68642701 TTTGCAGCCCCTGCACTTAATGG - Intergenic
1054775268 9:69119843-69119865 TTTGCAGACCCTGCACTCGATGG + Intergenic
1055450374 9:76425918-76425940 TTTGCAGGCCCTGCACTTGATGG - Intronic
1055851054 9:80630524-80630546 TTTGCAGACCCTGCACTTGATGG + Intergenic
1056220992 9:84450649-84450671 TTTGCAGACCCTGCACTTGATGG + Intergenic
1056391375 9:86144505-86144527 TTTGCAGACCTTGCACTTGATGG - Intergenic
1056518173 9:87374486-87374508 TTTGCAGACCTTGCACTTGAGGG - Intergenic
1056638964 9:88354059-88354081 TTTGCAGACCCTGCACTTGATGG + Intergenic
1056640177 9:88363079-88363101 TTTGCAGGCCCTGTACTTGATGG - Intergenic
1057366399 9:94425602-94425624 TTTGCAGACCCTGCACTTAATGG - Intronic
1057779697 9:98039623-98039645 TTTGCAGACGCTGCACTTGATGG + Intergenic
1057781646 9:98055506-98055528 TTTGCAGACCCTGCACTTGATGG - Intergenic
1058113243 9:101054699-101054721 TTGGAATTCCCTCCATTTGATGG - Intronic
1058214494 9:102216947-102216969 TTTGCAGACCCTGCACTTGATGG - Intergenic
1058829570 9:108803462-108803484 TTTGCAGACCCTGCACTTGATGG + Intergenic
1058995502 9:110294810-110294832 TTTGCAGTCCCTGCACTTGATGG - Intergenic
1059136380 9:111810613-111810635 TTTGTAGACCCTGCACTTGATGG + Intergenic
1059689800 9:116674197-116674219 TTTGCAGACCCTGCACTTGATGG + Intronic
1059690868 9:116685140-116685162 TTTGCAGACCCTGCACTTGATGG + Intronic
1060294402 9:122333425-122333447 CTGGAAGTCCCTGCCCTTGAGGG - Intergenic
1060499996 9:124146021-124146043 TTTTCAGACCCTGCACTTGATGG + Intergenic
1060502688 9:124173935-124173957 TTTGCAGACCCTGCACTTGATGG - Intergenic
1061561340 9:131405865-131405887 GTGGTAGAACCTGGACTTGAAGG - Intronic
1061885502 9:133589312-133589334 TTGGCTGTCCCGGCAATTGAAGG - Intergenic
1062130595 9:134890945-134890967 TTTGCAGACCTTGCACTTGATGG + Intergenic
1062228718 9:135468958-135468980 TTTGCAGATCCTGCACTTGATGG + Intergenic
1062709280 9:137964994-137965016 TTGGTTTTCCCTGTACTTGGTGG + Intronic
1185791776 X:2932658-2932680 TCTGTAGTCCCAGCACTTTAGGG - Intergenic
1185817786 X:3172461-3172483 CTTGCAGACCCTGCACTTGATGG + Intergenic
1185960129 X:4539914-4539936 TTTGCAGACCCTTCACTTGATGG + Intergenic
1186027238 X:5326568-5326590 TTTGTGGACCCTGCACTTGATGG - Intergenic
1186036650 X:5430169-5430191 TTTGTAGACCCTGCACTCAAAGG + Intergenic
1186278902 X:7971477-7971499 TTTGCAGACCCTGCCCTTGATGG - Intergenic
1186498158 X:10029001-10029023 TAGGTAGTCCCTGCAGTTAGTGG - Intronic
1187056627 X:15746851-15746873 TTTGCAGACCCTGCACTTGATGG - Intronic
1187536671 X:20147232-20147254 TTTGCAGACCCTGCACTTGATGG + Intergenic
1188104400 X:26132099-26132121 TAGGTACTTCCTGCACTTAATGG - Intergenic
1188138643 X:26521200-26521222 TTTGCAGACCCTGAACTTGACGG - Intergenic
1188518966 X:31016518-31016540 TTTGCAGACCCTGCACTTGATGG - Intergenic
1188686460 X:33076056-33076078 TTTGCAGACCCTGCACTCGATGG + Intronic
1188686590 X:33077081-33077103 TTTGCAGACCCTGCACTTGATGG - Intronic
1188687373 X:33084621-33084643 TTTGCAGACCCTGCACTTGATGG - Intronic
1188751147 X:33907131-33907153 TTTGCAGACCCTGCACTGGATGG + Intergenic
1189619670 X:42822101-42822123 TTTGCAGACCCTGCGCTTGATGG - Intergenic
1189631618 X:42960325-42960347 TTTCCAGACCCTGCACTTGATGG - Intergenic
1189784796 X:44549823-44549845 TTTGCAGACCCTGCACTTGATGG + Intergenic
1189789576 X:44590697-44590719 TTTGCAGACCCTGCACTTGATGG + Intergenic
1189792825 X:44619892-44619914 TTTGCAGACCCTGCACTTGACGG + Intergenic
1190368639 X:49721082-49721104 TTTGTAGACCCTGCACTTGGTGG + Intergenic
1190477545 X:50842770-50842792 TTTGCAGACCCTGCACTTGATGG - Intergenic
1190478495 X:50851136-50851158 TTTGCAGACCCTGCACTTGATGG - Intergenic
1191219603 X:57974113-57974135 TTTGCAGACCCTGTACTTGATGG - Intergenic
1192435107 X:71138226-71138248 CTGGTAGTCCCAGCACTTGGGGG + Intronic
1192707142 X:73538218-73538240 TATGCAGTCTCTGCACTTGAAGG - Intergenic
1193125561 X:77866857-77866879 TTTGCAGACTCTGCACTTGATGG + Intronic
1193523556 X:82560422-82560444 TTTGCAGACCCTGCACTAGATGG + Intergenic
1193530072 X:82645612-82645634 TTTGCAGACCCTGCACTTGATGG + Intergenic
1193961080 X:87925222-87925244 TTTGCAGACCCTGCACTTGATGG + Intergenic
1194294332 X:92109548-92109570 TTTGCAAACCCTGCACTTGATGG - Intronic
1194302351 X:92203863-92203885 TTTCCAGACCCTGCACTTGATGG - Intronic
1194316620 X:92384731-92384753 TTTGCAGATCCTGCACTTGATGG - Intronic
1194447726 X:94008222-94008244 TTTGCAGACCTTGCACTTGATGG - Intergenic
1194718278 X:97311639-97311661 TGTGCAGACCCTGCACTTGATGG - Intronic
1194758498 X:97765957-97765979 TGTGCAGACCCTGCACTTGATGG - Intergenic
1194808767 X:98364393-98364415 TTTGCAGACCCTGCACTCGATGG + Intergenic
1194960041 X:100224534-100224556 TTTGCAGACCCTGCACTTGATGG + Intergenic
1195258579 X:103111982-103112004 TTTGCAGACCCTGCACTTGATGG + Intergenic
1195415569 X:104616591-104616613 TTTGCAGACCCTGCACTTGATGG + Intronic
1196082244 X:111645437-111645459 TTTGCAGACCCTGCACTTGATGG - Intergenic
1196543835 X:116939633-116939655 TTTGCAGACCCTGCACTTGATGG + Intergenic
1196649079 X:118150475-118150497 TTTGCAGACCCTGCACTTGATGG + Intergenic
1196862711 X:120042804-120042826 TTTGTAAACCCTGCACTTGATGG + Intergenic
1196880391 X:120193540-120193562 TTTGTAAACCCTGCACTTGATGG - Intergenic
1197067031 X:122245693-122245715 TTTTCAGACCCTGCACTTGATGG - Intergenic
1197776650 X:130122492-130122514 TTGCTTGTCACTGCACTTCAGGG + Intergenic
1199967529 X:152832320-152832342 TTTGTTGTCCCTCCACTAGAAGG + Intronic
1199993481 X:153003794-153003816 TTTGCAGCCCCTGCGCTTGATGG + Intergenic
1200611838 Y:5334066-5334088 TTTGCAAACCCTGCACTTGATGG - Intronic
1200624796 Y:5498051-5498073 TTTGCAGATCCTGCACTTGATGG - Intronic
1201281875 Y:12349615-12349637 TCTGTAGTCCCAGCACTTTAGGG + Intergenic
1201296513 Y:12467859-12467881 TTTGCAGACCCTGCACTGGATGG + Intergenic
1201725280 Y:17143580-17143602 TTTGCAGACCCTGCACTCGATGG + Intergenic