ID: 1181269672

View in Genome Browser
Species Human (GRCh38)
Location 22:21651878-21651900
Sequence AGCGCTTGGAAGCCCGGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181269672_1181269680 29 Left 1181269672 22:21651878-21651900 CCCTCACCGGGCTTCCAAGCGCT No data
Right 1181269680 22:21651930-21651952 GATTGGAGCTGAGAAAAGGCGGG No data
1181269672_1181269679 28 Left 1181269672 22:21651878-21651900 CCCTCACCGGGCTTCCAAGCGCT No data
Right 1181269679 22:21651929-21651951 AGATTGGAGCTGAGAAAAGGCGG No data
1181269672_1181269678 25 Left 1181269672 22:21651878-21651900 CCCTCACCGGGCTTCCAAGCGCT No data
Right 1181269678 22:21651926-21651948 CAGAGATTGGAGCTGAGAAAAGG No data
1181269672_1181269677 12 Left 1181269672 22:21651878-21651900 CCCTCACCGGGCTTCCAAGCGCT No data
Right 1181269677 22:21651913-21651935 GCTAGAAAACTCGCAGAGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181269672 Original CRISPR AGCGCTTGGAAGCCCGGTGA GGG (reversed) Intergenic
No off target data available for this crispr