ID: 1181269707

View in Genome Browser
Species Human (GRCh38)
Location 22:21652107-21652129
Sequence GCGAATCCCCGCGCCAGCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181269700_1181269707 28 Left 1181269700 22:21652056-21652078 CCGGAGGCTATTTTGAAATCTCT No data
Right 1181269707 22:21652107-21652129 GCGAATCCCCGCGCCAGCGCCGG No data
1181269699_1181269707 29 Left 1181269699 22:21652055-21652077 CCCGGAGGCTATTTTGAAATCTC No data
Right 1181269707 22:21652107-21652129 GCGAATCCCCGCGCCAGCGCCGG No data
1181269706_1181269707 -5 Left 1181269706 22:21652089-21652111 CCAACAGGCATGCAGGAGGCGAA No data
Right 1181269707 22:21652107-21652129 GCGAATCCCCGCGCCAGCGCCGG No data
1181269703_1181269707 4 Left 1181269703 22:21652080-21652102 CCGTCTCAGCCAACAGGCATGCA No data
Right 1181269707 22:21652107-21652129 GCGAATCCCCGCGCCAGCGCCGG No data
1181269702_1181269707 5 Left 1181269702 22:21652079-21652101 CCCGTCTCAGCCAACAGGCATGC No data
Right 1181269707 22:21652107-21652129 GCGAATCCCCGCGCCAGCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181269707 Original CRISPR GCGAATCCCCGCGCCAGCGC CGG Intergenic
No off target data available for this crispr