ID: 1181277043

View in Genome Browser
Species Human (GRCh38)
Location 22:21693881-21693903
Sequence AGCGGCTGTGTGAAGCCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 193}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181277032_1181277043 19 Left 1181277032 22:21693839-21693861 CCTACCTGGACAAGAAGCATACC 0: 1
1: 0
2: 1
3: 7
4: 110
Right 1181277043 22:21693881-21693903 AGCGGCTGTGTGAAGCCTGGGGG 0: 1
1: 0
2: 0
3: 21
4: 193
1181277038_1181277043 -2 Left 1181277038 22:21693860-21693882 CCATCTTTGGACGGTAAGGGAAG 0: 1
1: 0
2: 0
3: 3
4: 125
Right 1181277043 22:21693881-21693903 AGCGGCTGTGTGAAGCCTGGGGG 0: 1
1: 0
2: 0
3: 21
4: 193
1181277033_1181277043 15 Left 1181277033 22:21693843-21693865 CCTGGACAAGAAGCATACCATCT 0: 1
1: 0
2: 1
3: 11
4: 146
Right 1181277043 22:21693881-21693903 AGCGGCTGTGTGAAGCCTGGGGG 0: 1
1: 0
2: 0
3: 21
4: 193
1181277031_1181277043 25 Left 1181277031 22:21693833-21693855 CCTGTGCCTACCTGGACAAGAAG 0: 1
1: 0
2: 0
3: 12
4: 160
Right 1181277043 22:21693881-21693903 AGCGGCTGTGTGAAGCCTGGGGG 0: 1
1: 0
2: 0
3: 21
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181277043 Original CRISPR AGCGGCTGTGTGAAGCCTGG GGG Intronic
900387606 1:2417668-2417690 AGGGGCTGTGTGCTGGCTGGAGG + Intergenic
901229586 1:7634356-7634378 GGCAGCTGTGGGAAGCCTGGAGG + Intronic
901399366 1:9005518-9005540 AGCGGGGGTGGGAAGCTTGGAGG - Intronic
902406499 1:16186686-16186708 AGCTGTTGTGAGAATCCTGGGGG + Intergenic
902772168 1:18651778-18651800 GGTGGCACTGTGAAGCCTGGAGG - Intronic
902794772 1:18793918-18793940 AGCGACTGTGAGGATCCTGGAGG + Intergenic
905307068 1:37027177-37027199 AGAGGCAGTGTGGACCCTGGAGG + Intronic
906686526 1:47766690-47766712 AGAGGCTGTGTGGTGGCTGGCGG + Intronic
912383025 1:109257809-109257831 GGCTGCTGTGGGTAGCCTGGGGG - Intronic
913159115 1:116129330-116129352 AGCAGCTCTGTGCAGCCTGCTGG + Intronic
917480805 1:175410466-175410488 AGCTGCTCTGAGAAGGCTGGAGG + Intronic
917784398 1:178437146-178437168 AGGGGCTGGGTGCAGCCTGAAGG + Intronic
922748688 1:228060816-228060838 AGCAGCTCTGGGCAGCCTGGGGG - Exonic
922895773 1:229098966-229098988 AGAGGCTGTGTCCACCCTGGAGG - Intergenic
1062802567 10:390931-390953 AGGGTCTGTGTGAACGCTGGAGG - Intronic
1063144932 10:3288362-3288384 AGCGGCTGCGTGCAGCCCGCAGG + Intergenic
1063581978 10:7316376-7316398 AGGGGCTGGGTGGAGGCTGGTGG + Intronic
1066375462 10:34854252-34854274 AGGGGCTGCGTGTAACCTGGAGG - Intergenic
1067764535 10:49075161-49075183 AGCCTCTCTGTGAGGCCTGGAGG + Intronic
1072912618 10:99517249-99517271 ATCTGCTGTGTGAATCCAGGAGG + Intergenic
1074105733 10:110388551-110388573 AGGGGCTGGGGGAAGTCTGGAGG - Intergenic
1075105624 10:119538398-119538420 AGCTGCTCTGTCAAGCATGGAGG + Intronic
1075726187 10:124612053-124612075 AGGGGCTGTGGGCAGCCTGGAGG - Intronic
1077400649 11:2355179-2355201 AGTGGCTGAGTGAACCCTGAAGG + Intergenic
1079360110 11:19763507-19763529 GAGGGTTGTGTGAAGCCTGGGGG + Intronic
1080227554 11:29976759-29976781 GGGGGCTGTCTGAAGCCTTGAGG - Intergenic
1083083196 11:60114629-60114651 AGCAGCAGTGTGGAGCCTTGGGG + Intergenic
1085044702 11:73346082-73346104 AGAGGCTGTGTGACCCCTTGGGG + Intronic
1086947065 11:92853905-92853927 AGGGACTATCTGAAGCCTGGGGG - Intronic
1089291828 11:117441854-117441876 GGGGGCGGTGAGAAGCCTGGGGG + Intronic
1089306230 11:117528020-117528042 AACGGCCTTGTGAAGTCTGGAGG - Intronic
1089328011 11:117670577-117670599 AGCTGCTGCGTGAAGGCTGACGG + Intronic
1092155767 12:6280699-6280721 AGCAGCCATGTGGAGCCTGGAGG - Intergenic
1092996931 12:13959470-13959492 AGCAGCTGTGTGGAGGGTGGAGG + Intronic
1094465949 12:30754514-30754536 GGCGGCTGTGGGAAGGGTGGGGG - Exonic
1094581473 12:31737665-31737687 GGCGGCAGTGTGAAGAATGGAGG + Intergenic
1095993440 12:48055444-48055466 AGCTGCTGACTGATGCCTGGGGG - Intronic
1101671146 12:106874677-106874699 AGCGGCTATGTCCAGCATGGAGG - Intronic
1103278518 12:119734247-119734269 AGCGGCAGTGGGAGGCCTGGAGG - Exonic
1103856446 12:123973517-123973539 AGCGGCTCCGCGCAGCCTGGCGG + Exonic
1104606899 12:130196219-130196241 AGGGGCTGTGTGCATGCTGGTGG + Intergenic
1108140507 13:47416093-47416115 CGGGGCTGGGGGAAGCCTGGAGG + Intergenic
1114073419 14:19132811-19132833 GGCGGCAGCGTGAAGCCTGGCGG + Intergenic
1114088847 14:19267172-19267194 GGCGGCAGCGTGAAGCCCGGCGG - Intergenic
1114412892 14:22517469-22517491 AGCGTGTGTGTGTAGCCTTGAGG - Intergenic
1117009515 14:51455987-51456009 AGTGGGTGGGTGAAGCCTGCAGG + Intergenic
1117693488 14:58334894-58334916 AGAGGTTGTCTGAAGACTGGTGG - Intronic
1119221008 14:72907348-72907370 AGGGGCTGGGCCAAGCCTGGGGG + Intergenic
1119703264 14:76769112-76769134 GGAGGCTGAGGGAAGCCTGGGGG + Intronic
1119726758 14:76926114-76926136 AGCTGGTGTGTGGAGCCAGGAGG - Intergenic
1122203028 14:100133980-100134002 AGGAGCTTTGTGAGGCCTGGGGG - Intronic
1122297474 14:100713526-100713548 AGGGGCTGGATGGAGCCTGGGGG + Intergenic
1122312993 14:100809032-100809054 AGCAGCTCTGTAAAGCCTGCTGG + Intergenic
1122323564 14:100869353-100869375 TCCTGCTGTGTGGAGCCTGGAGG + Intergenic
1122323751 14:100870395-100870417 TCCTGCTGTGTGGAGCCTGGAGG + Intergenic
1122681319 14:103465715-103465737 AGTGGATGTGTGGAGTCTGGGGG + Exonic
1123701883 15:22920397-22920419 GGAGACTGTGTGAAGCCTTGGGG - Intronic
1125679295 15:41520834-41520856 AGGGGGTGTCTGAAGCCCGGTGG + Exonic
1127823077 15:62677353-62677375 ACTGACTGTGTGAAGCCTGATGG - Intronic
1128282717 15:66409754-66409776 AGCGGGGGTGTGAAGACTGGTGG - Intronic
1129660142 15:77548815-77548837 CCCGGCTGTGTGAAGGGTGGGGG + Intergenic
1131075645 15:89493500-89493522 AGGGGATGAGTGAAGCCTGCTGG - Intronic
1132376218 15:101329959-101329981 AGCAGGTGTGGGACGCCTGGGGG - Intronic
1132547871 16:541457-541479 AGGGGCCGTGTGGGGCCTGGTGG + Intronic
1132663661 16:1072375-1072397 AGTGGGTGTGTGGAGGCTGGTGG - Intergenic
1133071521 16:3249646-3249668 AGCGGCTGCCTGAGGCCTGGGGG + Exonic
1135429965 16:22374573-22374595 GGCGGCGGCGTGAAGACTGGCGG - Exonic
1135924476 16:26680571-26680593 AGAGGCTGGGTGAAAGCTGGAGG - Intergenic
1136342575 16:29654668-29654690 AGGGGCTGGCAGAAGCCTGGAGG - Intergenic
1136711387 16:32240115-32240137 GGGGGCTCTTTGAAGCCTGGAGG - Intergenic
1136756523 16:32689290-32689312 GGGGGCTCTTTGAAGCCTGGAGG + Intergenic
1136776637 16:32875340-32875362 AGGGGCTGTGTGAAGGCCTGGGG + Intergenic
1136811588 16:33181083-33181105 GGGGGCTCTTTGAAGCCTGGAGG - Intergenic
1136818064 16:33291163-33291185 GGGGGCTCTTTGAAGCCTGGAGG - Intronic
1136824628 16:33347692-33347714 GGGGGCTCTTTGAAGCCTGGAGG - Intergenic
1136829694 16:33446463-33446485 GGGGGCTCTTTGAAGCCTGGAGG - Intergenic
1136893980 16:33986173-33986195 AGGGGCTGTGTGAAGGCCTGGGG - Intergenic
1141881154 16:86860462-86860484 AGCGGCCGTGTTGAGCATGGAGG + Intergenic
1142054604 16:87985162-87985184 AGGGGGTGTGGGAAGTCTGGGGG + Intronic
1142230018 16:88895708-88895730 AGGGGCTGTGGGAGGCCAGGAGG + Intronic
1202990166 16_KI270728v1_random:4052-4074 GGGGGCTCTTTGAAGCCTGGAGG - Intergenic
1203058668 16_KI270728v1_random:949644-949666 GGGGGCTCTTTGAAGCCTGGAGG + Intergenic
1203079052 16_KI270728v1_random:1137449-1137471 AGGGGCTGTGTGAAGGCCTGGGG + Intergenic
1142537386 17:628281-628303 AGTGGCTGTGAGAAGCCATGAGG - Intronic
1143021511 17:3919232-3919254 AGCGGCTCTGTGCAGCGTGGAGG + Intergenic
1143127908 17:4656467-4656489 ACCGGGTGGGTGAAGCCAGGTGG - Intergenic
1145403036 17:22559279-22559301 AGCGGCTGTGCTCAGCCTTGAGG + Intergenic
1146741529 17:35288263-35288285 AGCTGCCATGTGAAGCCTGAGGG - Intergenic
1149686204 17:58536688-58536710 GGGGGCTGAATGAAGCCTGGAGG - Intronic
1151199269 17:72455772-72455794 AGAGGCTGCGTGCACCCTGGTGG + Intergenic
1151456758 17:74231103-74231125 AGGGGCTGTGTGACGCCTGAGGG + Intronic
1151779946 17:76239549-76239571 AGAGGCTGTCAGAAGCCGGGGGG - Intronic
1154411915 18:14146203-14146225 AGCAGCTCTCTGAAGCATGGGGG + Intergenic
1156406108 18:36784075-36784097 AGCGGCTGTGCTATTCCTGGAGG - Intronic
1160190517 18:76710949-76710971 AGCGGCTCTGGGCAGCCTGCAGG + Intergenic
1160215073 18:76921475-76921497 AGCAGTTGTGTGTGGCCTGGAGG + Intronic
1160717749 19:584078-584100 AGCGGCTGTGTCAGCCCTGCAGG + Intergenic
1161283139 19:3456445-3456467 CCCGGCTGTGTGACGCCTGGCGG + Intronic
1161668321 19:5590295-5590317 AGAGGCTGAGTGAAGGCCGGGGG - Exonic
1165230647 19:34384430-34384452 AGAAGCTGTGTTAAGCATGGTGG + Intronic
1165491204 19:36123986-36124008 AGCGGCTGTGGGAAGCAGTGTGG - Intronic
1166366430 19:42280694-42280716 AGCGGCTTTGTGGAGCCTGCCGG + Intronic
1166702734 19:44891509-44891531 GGCGGCAGCGTGAAGCCCGGCGG - Exonic
1166862399 19:45817913-45817935 AGCTGCTGTCTGCAGCCTGGAGG + Intronic
1167851955 19:52208941-52208963 AGCCTCTCTGTGAAGTCTGGGGG - Intronic
1168386064 19:55964143-55964165 AGGGGCCATGTGATGCCTGGTGG - Intronic
1168682533 19:58326630-58326652 GGCGGCTGTGTGAGGGCTGAGGG - Intergenic
1168682553 19:58326725-58326747 GGCGGCTGTGTGAGGGCTGAGGG - Intergenic
926135101 2:10330904-10330926 AGCTTCTGGGTGCAGCCTGGGGG + Intronic
926426173 2:12740464-12740486 AGCCGACGTGTGGAGCCTGGGGG + Exonic
926695581 2:15768076-15768098 AGTGGCTGTGTGGATGCTGGAGG - Intergenic
929088515 2:38192312-38192334 GGCAGCTGTCTGAAGCCAGGAGG - Intergenic
932463554 2:71898584-71898606 TGAGGCTGCGGGAAGCCTGGAGG - Intergenic
934872769 2:97882503-97882525 AGCTGCTGTTTGAAGCCTCTTGG - Intronic
937491739 2:122376335-122376357 AGTGACTTTGTGGAGCCTGGTGG + Intergenic
937660611 2:124426377-124426399 AGCTGCTGTGGAAACCCTGGTGG + Intronic
938068099 2:128292640-128292662 AAGGGCTGTGGGAAGCCGGGAGG + Intronic
938487344 2:131724164-131724186 GGCGGCAGCGTGAAGCCCGGCGG + Intronic
946130105 2:217600118-217600140 AGCTGCAGTGTGGAGGCTGGGGG - Intronic
949043392 2:241859384-241859406 AGAGGCTGTGGGCAGCCGGGAGG - Intergenic
1169308252 20:4513291-4513313 AGAGGATTTGTGATGCCTGGGGG + Intergenic
1170002286 20:11628041-11628063 AGGTGCTAGGTGAAGCCTGGGGG - Intergenic
1172300136 20:33844032-33844054 AGAGGCTGTGTGAACCCTGCAGG + Intronic
1172893209 20:38281708-38281730 CGCTGCTCTGTGAAGCCTTGAGG - Intronic
1174806572 20:53608705-53608727 ACCCGCTGTGTGAGGGCTGGGGG - Intronic
1175138549 20:56842786-56842808 AGGGACTGCCTGAAGCCTGGGGG + Intergenic
1176861118 21:14012129-14012151 AGCAGCTTTCTGAAGCATGGGGG - Intergenic
1180491861 22:15855164-15855186 GGCGGCAGCGTGAAGCCCGGCGG + Intergenic
1181165337 22:20980130-20980152 TGTGGGTGTGGGAAGCCTGGGGG + Intronic
1181277043 22:21693881-21693903 AGCGGCTGTGTGAAGCCTGGGGG + Intronic
1181521647 22:23451877-23451899 AGCCTCTGTGGGAAGCCTGGGGG + Intergenic
1181718284 22:24751753-24751775 AGTGGCTGCCTGAAGGCTGGTGG - Intronic
1183260908 22:36795297-36795319 AGGGGCTGTGAGGAGCCTGCAGG + Intergenic
1183429115 22:37755192-37755214 TGAGGCTGTGTGCAGCTTGGGGG + Intronic
1183927401 22:41216102-41216124 AGAGGCTATGTGTAGCCTGGCGG - Intronic
1184258612 22:43301703-43301725 AGGGGCTCTGTGTTGCCTGGGGG - Intronic
1184643480 22:45884227-45884249 AGCGTCTGTGTCCAGCCGGGAGG + Intergenic
1184743246 22:46441372-46441394 AGCGGCTGTGTGAATCCCACTGG - Intronic
1184796833 22:46737891-46737913 AGCGGCTGTGGTAAGGCCGGGGG - Intronic
950018043 3:9768117-9768139 AGCAGCTGGTAGAAGCCTGGAGG + Intronic
950935599 3:16835780-16835802 AACAGCCGTGTGAGGCCTGGTGG - Intronic
953452263 3:43015054-43015076 AGTGGCTGTGTGAAGCCACTAGG + Intronic
954380209 3:50215296-50215318 AGGGGCTCTGGGAGGCCTGGGGG - Intronic
955060203 3:55487053-55487075 AGCGACCGGGTTAAGCCTGGGGG + Exonic
955253559 3:57307042-57307064 GGGGGCTGTCTGAAGCCTTGTGG - Intronic
955751641 3:62189848-62189870 AGCTGCAGTGAGAAGCCTTGGGG - Intronic
961739635 3:129025054-129025076 AGAGGCTGTGAGAAGCCTGTGGG + Intronic
967133350 3:186492899-186492921 AGCAGCTGTGGGCAGGCTGGAGG - Intergenic
968005267 3:195238323-195238345 GGAGGCTGTGGGAAGGCTGGAGG - Intronic
968909450 4:3470094-3470116 AGCCCCTCTGGGAAGCCTGGAGG - Intronic
970426008 4:15947030-15947052 AGTAGCTGTGTGAAGCTTGTGGG + Intergenic
970905034 4:21205765-21205787 AGCTGGTGTTTGAAGCCAGGCGG + Intronic
971427967 4:26534355-26534377 AGACTCTGTGTGGAGCCTGGAGG + Intergenic
978663429 4:111154628-111154650 AGGGGCAGCCTGAAGCCTGGAGG - Intergenic
979168267 4:117564707-117564729 AGCAGCTGTGCCTAGCCTGGTGG + Intergenic
980356433 4:131733702-131733724 CGCGTCTCTGCGAAGCCTGGCGG + Intergenic
984169443 4:176343315-176343337 AGGGACAGAGTGAAGCCTGGGGG - Intergenic
985576785 5:677337-677359 AGTGGCTGCCTGGAGCCTGGAGG - Intronic
987208045 5:15647934-15647956 ACTGCCTCTGTGAAGCCTGGGGG + Intronic
988487918 5:31682162-31682184 AGCTGCTGTGTGTTTCCTGGAGG + Intronic
989520655 5:42396534-42396556 AGGGGAGGTCTGAAGCCTGGGGG + Intergenic
994506672 5:100651275-100651297 AGAGACAGTGTGAAGCGTGGAGG + Intergenic
995023063 5:107388115-107388137 AGCGGCTCTGTGAAAGCTGGAGG - Intronic
996691283 5:126342930-126342952 GGCAGCTGTGTGCAGCCTGGGGG - Intergenic
997239231 5:132294601-132294623 AGCGGCAGTGGGAAGCATGCGGG + Exonic
998423175 5:142005801-142005823 AGGGGCTGTGTGGAGCCTTCCGG + Intronic
998424543 5:142015138-142015160 AGGGTCTCTGCGAAGCCTGGAGG + Intergenic
999373197 5:151068729-151068751 ATGGGCTGTGGGCAGCCTGGAGG - Intronic
1003297798 6:4848804-4848826 GGCTTCTCTGTGAAGCCTGGTGG + Intronic
1003952634 6:11130398-11130420 ATAGGCTGTGTGAGGGCTGGGGG - Intronic
1006052982 6:31357526-31357548 AGGGGCTGGGCGCAGCCTGGGGG - Intergenic
1006386342 6:33733173-33733195 ATCTCCTGTGTGAAGCCTGAAGG + Intronic
1013942337 6:115679859-115679881 AAGGGCTGTGTGAAGGGTGGGGG - Intergenic
1015958259 6:138620925-138620947 AGTTTCTGTGTGAAGCCAGGTGG - Intronic
1016278580 6:142385099-142385121 AGAGGATGTGTCAATCCTGGAGG - Intronic
1019496464 7:1342692-1342714 AGCAGCTGTGTGTGGCATGGGGG + Intergenic
1019589690 7:1824606-1824628 AGCCTCTGTGGGAAGCCTGGGGG - Intronic
1019659729 7:2217433-2217455 AGAGCTGGTGTGAAGCCTGGAGG + Intronic
1019897343 7:3992481-3992503 GGCGGATGAGGGAAGCCTGGGGG + Intronic
1020192215 7:6009060-6009082 AGCGCCTGTGGGAGCCCTGGAGG - Exonic
1020756243 7:12207285-12207307 AGCAGCTCTGTGAAGGCTGGAGG - Intergenic
1024343592 7:48291183-48291205 AGTGGGTGGGTGAAGGCTGGAGG + Intronic
1024612623 7:51080579-51080601 AGCTTCTGTGAGATGCCTGGTGG + Intronic
1030359446 7:108579785-108579807 AGGAACAGTGTGAAGCCTGGGGG + Intergenic
1033237286 7:139648437-139648459 AGCGGCAGAGAGAAGCGTGGAGG + Intronic
1034416597 7:150968370-150968392 AGTGGGTGGGTGAAGCGTGGCGG + Intronic
1035068329 7:156123668-156123690 AGAGGGTGTGTGCAGCCAGGCGG - Intergenic
1037803592 8:22048075-22048097 GGCGGCTGCGGGAAGCCTGGCGG - Exonic
1037880906 8:22572957-22572979 AGAGGCCATGTGAAGCCTGGTGG - Intronic
1038782623 8:30581208-30581230 TGAGGCTCTGTGAAGCCTCGGGG - Intronic
1039063965 8:33593674-33593696 ACCGGCTGTGTGAGGCATTGAGG + Exonic
1039567905 8:38564415-38564437 AGCGGCAGTGAGGACCCTGGAGG + Intergenic
1040559863 8:48514624-48514646 AGCGGCTGGGCGGAGCCAGGTGG + Intergenic
1042068679 8:64906584-64906606 ATCAGCTGTGTGAAGCATTGAGG - Intergenic
1042556118 8:70034992-70035014 AGGGGCTGTTTGAAGCCTTTCGG - Intergenic
1043708050 8:83378217-83378239 AGAGACGGCGTGAAGCCTGGGGG - Intergenic
1045963319 8:107994983-107995005 AGAGGCTGTGGGAAGCTTTGGGG - Intronic
1047513881 8:125536811-125536833 ATCTGCTGTGTGATGCATGGAGG - Intergenic
1049492042 8:142910461-142910483 GGAGGCTGTGTGAAGGGTGGCGG + Intronic
1056990736 9:91407702-91407724 AGTGGCTGGGTGAAGCCCAGAGG - Intergenic
1057748783 9:97773240-97773262 TGCAGGTGTGTGGAGCCTGGGGG - Intergenic
1060297005 9:122349805-122349827 CGTGGCTCAGTGAAGCCTGGTGG + Intergenic
1060478106 9:124000133-124000155 AGCGGCAGGGTGAGGGCTGGGGG - Intergenic
1061072094 9:128317127-128317149 AGGTGATGTGAGAAGCCTGGGGG - Intronic
1061359146 9:130130084-130130106 AGAAGCTGTGTCAGGCCTGGTGG - Intronic
1061429065 9:130519673-130519695 AGCGGCTGAGCGGAGCCTGCTGG - Intergenic
1061594835 9:131622059-131622081 AGCTGCTGTGGGAAGAATGGGGG - Intronic
1061750916 9:132776473-132776495 AGTGGCTGTGAGAAGGGTGGTGG + Intronic
1062433249 9:136535246-136535268 AGGGGCCTTGTGAACCCTGGGGG - Intronic
1186203195 X:7174872-7174894 GGTGGCTTTGTGAAGCCAGGTGG - Intergenic
1193624456 X:83799576-83799598 AGGGGCTGTGAGAAGTCAGGGGG + Intergenic
1194212198 X:91082573-91082595 AGGGAATGTCTGAAGCCTGGGGG + Intergenic
1199095271 X:143731023-143731045 AGGGACTGTGAGAAGCCTGTAGG - Intergenic
1199412526 X:147541167-147541189 AGCTGCTGTGTGAATTCAGGAGG + Intergenic
1201385740 Y:13437749-13437771 AGCAGCTGTGTGAAACCTACTGG + Intronic