ID: 1181283470

View in Genome Browser
Species Human (GRCh38)
Location 22:21735974-21735996
Sequence ACGTGGGCTCCTGCCCGTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 120}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181283470_1181283479 17 Left 1181283470 22:21735974-21735996 CCGGGACGGGCAGGAGCCCACGT 0: 1
1: 0
2: 0
3: 8
4: 120
Right 1181283479 22:21736014-21736036 ACTCCCATTGGCTGACCCGCCGG 0: 1
1: 0
2: 0
3: 3
4: 51
1181283470_1181283477 5 Left 1181283470 22:21735974-21735996 CCGGGACGGGCAGGAGCCCACGT 0: 1
1: 0
2: 0
3: 8
4: 120
Right 1181283477 22:21736002-21736024 GGGGCGCGCCGCACTCCCATTGG 0: 1
1: 0
2: 1
3: 4
4: 39
1181283470_1181283484 29 Left 1181283470 22:21735974-21735996 CCGGGACGGGCAGGAGCCCACGT 0: 1
1: 0
2: 0
3: 8
4: 120
Right 1181283484 22:21736026-21736048 TGACCCGCCGGGCGCGGCCTCGG 0: 1
1: 0
2: 0
3: 16
4: 658
1181283470_1181283483 23 Left 1181283470 22:21735974-21735996 CCGGGACGGGCAGGAGCCCACGT 0: 1
1: 0
2: 0
3: 8
4: 120
Right 1181283483 22:21736020-21736042 ATTGGCTGACCCGCCGGGCGCGG 0: 1
1: 0
2: 0
3: 16
4: 75
1181283470_1181283480 18 Left 1181283470 22:21735974-21735996 CCGGGACGGGCAGGAGCCCACGT 0: 1
1: 0
2: 0
3: 8
4: 120
Right 1181283480 22:21736015-21736037 CTCCCATTGGCTGACCCGCCGGG 0: 1
1: 0
2: 0
3: 13
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181283470 Original CRISPR ACGTGGGCTCCTGCCCGTCC CGG (reversed) Intergenic
900030069 1:364811-364833 TCTTGGCCTCCTGCCCTTCCTGG - Intergenic
900050721 1:593875-593897 TCTTGGCCTCCTGCCCTTCCTGG - Intergenic
900205777 1:1431359-1431381 AGGTGGGGTCCTGCCCCTGCAGG - Intergenic
900564768 1:3326843-3326865 AGGTGGGCTCCTGCCCCCACTGG + Intronic
900589775 1:3454493-3454515 ACGTGGGCTCCAGCCGGCCCAGG + Exonic
901005991 1:6171772-6171794 AGGTGGCATCCTGCCCGTCCCGG + Intronic
903683872 1:25116787-25116809 ACGTGGGCTCCTGGAGGGCCTGG - Intergenic
907267403 1:53271357-53271379 ACATGGGCTCCTGAAGGTCCAGG + Intronic
914203387 1:145505942-145505964 CCGTGGGCTCCTGTGCGGCCGGG - Intergenic
914482509 1:148079096-148079118 CCGTGGGCTCCTGTGCGGCCGGG - Intergenic
918595552 1:186288682-186288704 ACGAGGTCTCCTGACCATCCCGG + Intergenic
919464168 1:197911373-197911395 ATGTGGCCTCCGCCCCGTCCCGG + Intergenic
923565657 1:235074101-235074123 ACCTGAGCTCCTGCCCTGCCGGG + Intergenic
1066703755 10:38156670-38156692 CCGGGGCCTCCTGCCCGACCCGG - Intergenic
1070179465 10:73999372-73999394 ACGTGGGCTCCACCTCCTCCAGG - Intronic
1070782016 10:79143149-79143171 AAGTGTGCTCCTGACCTTCCAGG + Intronic
1072809354 10:98446975-98446997 ACGGCGGCTCCGGCCCCTCCCGG - Intergenic
1077233743 11:1470144-1470166 ACGTGTGCCCCTGTCCGGCCCGG + Exonic
1078053083 11:7984336-7984358 ATGTGGGTTCCTGGCTGTCCTGG - Intronic
1078627250 11:12968815-12968837 ACATGGGCTCCAGCAAGTCCTGG + Intergenic
1079133110 11:17761033-17761055 ACGTGGACCCCTGCCTGTCTTGG - Intronic
1090188076 11:124751366-124751388 TCCTGGGCTCCTGTCCCTCCAGG + Intronic
1090940357 11:131382262-131382284 AAGTGGGATCCTGCACCTCCAGG - Intronic
1091934621 12:4425205-4425227 ACGTGGACTTCTTTCCGTCCAGG + Intergenic
1096550212 12:52367211-52367233 ACCTGGGCTCCTGCGGGCCCCGG - Exonic
1106137772 13:26987012-26987034 ACGTGGGGACTTGCCCCTCCAGG - Intergenic
1112226544 13:97545573-97545595 CCGTGGGATCCTGCGCCTCCCGG + Intergenic
1117722156 14:58638334-58638356 GCGTGGCCTCCTGCCGCTCCCGG - Exonic
1118213735 14:63788648-63788670 AGGGGGGTTCCTGCCTGTCCCGG + Intergenic
1121316230 14:92962547-92962569 ACGTGCTCTCCTGCCTGGCCTGG - Intronic
1122135088 14:99628150-99628172 ACCTGGGCTCCTGCCTGCCTGGG - Intergenic
1122769761 14:104092746-104092768 GTGTGGGCTCCTCCCAGTCCCGG + Intronic
1122823481 14:104358708-104358730 AAGTGAGCCCCTGCCCGGCCTGG - Intergenic
1123045062 14:105508162-105508184 ACATCGGCTCCTGTCCGTGCAGG + Intergenic
1124011733 15:25844658-25844680 AAGAGGGCTCCTGCCCCTCCTGG + Intronic
1129270682 15:74417809-74417831 GCGTGGGCTTCTGCCCCTCATGG - Intronic
1129382876 15:75178771-75178793 ACGTGGGAGCCTTCCCGCCCTGG - Intergenic
1132625188 16:888209-888231 CCGTGGGTCCCTGCCCGCCCAGG + Intronic
1134450236 16:14358862-14358884 CCGGGGGTTCCTCCCCGTCCTGG - Intergenic
1136454411 16:30372174-30372196 AAGTGGGCTCCTCCCTGGCCTGG + Intronic
1136698597 16:32110577-32110599 ACGTGGGCTTCTGACCCTTCAGG - Intergenic
1136799098 16:33053871-33053893 ACGTGGGCTTCTGACCCTTCAGG - Intergenic
1139205304 16:65023137-65023159 AGGTGTGCTTCTGCCTGTCCAGG + Intronic
1139475141 16:67199292-67199314 ACGTGGGCGCCTGCACTTTCCGG - Exonic
1139509294 16:67417287-67417309 GCGTGAGCCCCTGCCCGGCCGGG + Intergenic
1141995191 16:87632529-87632551 TCCTGGGCTCCAGCCCCTCCTGG + Intronic
1142287650 16:89177925-89177947 ACGGCGGGTCCTGCCTGTCCTGG - Intronic
1142518867 17:491418-491440 CCTGGCGCTCCTGCCCGTCCCGG + Intergenic
1144057771 17:11557785-11557807 ACGGCGGCACCTGCCCGACCTGG + Exonic
1144870056 17:18363659-18363681 ACGCGGCCTCCGGCCCGCCCCGG - Intergenic
1146058815 17:29593906-29593928 ACGTGTGGTCCCGCCCGTCCCGG - Intronic
1146642968 17:34555178-34555200 AGCTGGGCTCCTGCCCTGCCAGG + Intergenic
1146654417 17:34626704-34626726 CCTCGGGCTCCAGCCCGTCCGGG - Intronic
1148440448 17:47709145-47709167 ACGCGGGCGCCTCCCCGCCCTGG + Exonic
1149621221 17:58046767-58046789 ACTTGGGCTCCTTCACTTCCTGG - Intergenic
1150288974 17:63971015-63971037 ACGTGGGCCCCTGTATGTCCAGG + Intronic
1150484183 17:65532687-65532709 AGGTGGACTCATCCCCGTCCAGG + Intronic
1151202101 17:72476168-72476190 ACCTGGGCAGCTGCCCGGCCAGG + Intergenic
1152949688 17:83221749-83221771 TCTTGGCCTCCTGCCCTTCCTGG + Intergenic
1155213031 18:23619269-23619291 ACGGGGCCTCCCGCCTGTCCTGG - Intronic
1160746848 19:715796-715818 ACGTGGGGTCCTGCCCCCTCTGG - Intronic
1161455999 19:4369989-4370011 GCGTGGGCTCCTGCCCGCTGGGG + Intronic
1161531303 19:4791770-4791792 AGGTTGCCTCCCGCCCGTCCGGG + Exonic
1163497501 19:17655333-17655355 ACATGGAGTCCTGCCCCTCCTGG + Exonic
1163833982 19:19562401-19562423 ACAAGGGCTCCTGCCCGGCGAGG + Intronic
1164618621 19:29680996-29681018 ATCTGGGCTCCGGCCTGTCCTGG + Intergenic
1165076519 19:33282604-33282626 ATGGGGGCTCCTGCCCTTCCAGG + Intergenic
1167118335 19:47501177-47501199 AGGTGGCCTCCTGCACCTCCCGG + Intronic
926474731 2:13308385-13308407 CCGTGGGCTCCTGCGCGGCCCGG - Intergenic
927142561 2:20140154-20140176 CCCTGGGCTCCTGCCCTGCCGGG + Intergenic
928158249 2:28895422-28895444 ACGTGTTCTCGTCCCCGTCCAGG + Intronic
928313987 2:30232113-30232135 AGGGGGGCTCCTGCTCTTCCCGG + Intronic
932593984 2:73083015-73083037 TCCTTGGCTCCTGCCTGTCCAGG + Intronic
934933204 2:98445095-98445117 GCGTCGCCTCCTGCCCGGCCCGG - Intronic
947202306 2:227625075-227625097 AGGTGGGCTGCTACCCCTCCCGG + Intronic
1168753235 20:298107-298129 ACGAGGGCGCCTGCCCGACCCGG + Exonic
1175708921 20:61203579-61203601 ACCTGGGGTCCTTCCCGCCCAGG + Intergenic
1176019032 20:62953252-62953274 ACCTGGCCTCCTGACTGTCCTGG - Intronic
1176052723 20:63129052-63129074 ACGTGGGCACCTGACTTTCCTGG + Intergenic
1176086140 20:63296462-63296484 GTGTGGGCTCCCACCCGTCCTGG - Intronic
1176429670 21:6567972-6567994 ACGTGGCCTCCTGCCCTGGCGGG - Intergenic
1179705064 21:43175434-43175456 ACGTGGCCTCCTGCCCTGGCGGG - Intergenic
1179793753 21:43770496-43770518 TCCTGGGCTCCTGCACGTTCTGG + Intergenic
1180837218 22:18935969-18935991 GCGGGGGCTTCTGCCGGTCCCGG - Intronic
1181131657 22:20735706-20735728 CCGTCGGCTCCTGGCCATCCTGG - Intronic
1181243297 22:21489533-21489555 CCGTCGGCTCCTGGCCATCCTGG - Intergenic
1181283470 22:21735974-21735996 ACGTGGGCTCCTGCCCGTCCCGG - Intergenic
1181540373 22:23569831-23569853 ATGTGGGATCCTGCCCACCCAGG + Intergenic
1183590452 22:38776626-38776648 ACGTGGACACCTGGCCTTCCAGG - Intronic
1184945636 22:47801970-47801992 ACCTGTGCACCTGCCCCTCCAGG + Intergenic
1185361132 22:50407692-50407714 ACCTGGGCTTCTGCCCCTCCAGG + Intronic
1203287311 22_KI270734v1_random:161268-161290 GCGGGGGCTTCTGCCGGTCCCGG - Intergenic
949259016 3:2083916-2083938 CCGTGGGCTCCTGTGCGGCCCGG + Intergenic
950640850 3:14347117-14347139 ACGTTGGCTCCTTCCCTTCTTGG - Intergenic
954137285 3:48587868-48587890 TCGCTGGCTCCAGCCCGTCCAGG + Exonic
968181553 3:196599108-196599130 CCGTGGGCTCCTGTGCGGCCCGG - Intergenic
968356393 3:198110875-198110897 ACCTGAGCTCCTGCGTGTCCAGG + Intergenic
968884395 4:3319838-3319860 AGGTGCCCTCCTGCCCGCCCTGG + Intronic
969674770 4:8608494-8608516 ACCTGGGCCCCTCCCTGTCCTGG + Intronic
970422611 4:15919463-15919485 ACGTGGGGCCCTGCCCTACCTGG + Intergenic
972148863 4:36064453-36064475 AAGTGGGCTCCTGTCCCTGCAGG + Intronic
978409892 4:108415560-108415582 AGGGGGGCTGCTGCCCCTCCAGG + Intergenic
978994339 4:115131324-115131346 AAGTGGACTCCTGCCTGCCCAGG + Intergenic
981752127 4:148102677-148102699 ACGCTGCCTCCTGCCCCTCCTGG + Intronic
988684505 5:33514216-33514238 TGGTGTGCTCCTGCCCATCCTGG - Intergenic
998417838 5:141958459-141958481 ACGTGGACTGATGCCCCTCCCGG + Exonic
999272842 5:150307640-150307662 ACCTGGGCTCTTGCCTATCCTGG - Intronic
1002743920 5:181455561-181455583 TCTTGGCCTCCTGCCCTTCCTGG + Intergenic
1006119403 6:31795105-31795127 GGGTGGGCTCCTCCCCATCCGGG + Exonic
1007982203 6:46170923-46170945 AGGTGAGCTCCTGCGCGTTCCGG - Exonic
1018972719 6:168539748-168539770 GCGTGGTCTCCTGGCCCTCCCGG + Intronic
1019248779 6:170728790-170728812 TCTTGGCCTCCTGCCCTTCCTGG + Intergenic
1019257068 7:59316-59338 ACATGGGCTCCTGCACTCCCAGG - Intergenic
1021911012 7:25385961-25385983 AAGTGGGCTCCTTCCCGGCAGGG - Intergenic
1032416261 7:131737666-131737688 ACGTGGGTTCCTGCTCCCCCTGG + Intergenic
1033033337 7:137847196-137847218 AGGTGGGCGCCCGCCGGTCCTGG - Intergenic
1035499266 8:78545-78567 TCTTGGCCTCCTGCCCTTCCTGG - Intronic
1035691735 8:1563616-1563638 AGGGGAGCTCCTGCTCGTCCAGG + Intronic
1035737132 8:1897274-1897296 ACGGCGGCTCCTGCTCCTCCTGG + Intronic
1039912840 8:41838347-41838369 CCCTGGGCTCCTGGCCATCCAGG - Intronic
1060583112 9:124770204-124770226 CCGAGGGCTCCAGCCCGCCCCGG - Intronic
1061043074 9:128150820-128150842 GCGTGGCCACCTGCCCCTCCAGG - Intronic
1061201032 9:129138667-129138689 ACGGGGGCTGCTCTCCGTCCGGG + Intronic
1062326593 9:136015375-136015397 AGGTGGGCCCCTACCCCTCCTGG + Intronic
1062332030 9:136049097-136049119 AGGAGGGCTGCTCCCCGTCCTGG - Intronic
1062452980 9:136623278-136623300 CCGTGGGCTCATGCCCCTCAGGG + Intergenic
1062564227 9:137156816-137156838 CCGTGGGGTCCTCCCCGTTCGGG - Intronic
1203609735 Un_KI270748v1:86054-86076 TCTTGGCCTCCTGCCCTTCCTGG + Intergenic
1200049253 X:153420044-153420066 GCAAGGGCTCCTGCGCGTCCAGG - Intronic