ID: 1181283623

View in Genome Browser
Species Human (GRCh38)
Location 22:21736503-21736525
Sequence GGGGCCAGACGCAGACCCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181283623_1181283627 -8 Left 1181283623 22:21736503-21736525 CCCCCGGGTCTGCGTCTGGCCCC No data
Right 1181283627 22:21736518-21736540 CTGGCCCCTCGCTCTGCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181283623 Original CRISPR GGGGCCAGACGCAGACCCGG GGG (reversed) Intergenic
No off target data available for this crispr