ID: 1181286499

View in Genome Browser
Species Human (GRCh38)
Location 22:21756234-21756256
Sequence CAGGCACATTATGCTATCTG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 106}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181286491_1181286499 16 Left 1181286491 22:21756195-21756217 CCTCTCAGTTCCCATCACCATTT 0: 1
1: 0
2: 1
3: 27
4: 268
Right 1181286499 22:21756234-21756256 CAGGCACATTATGCTATCTGTGG 0: 1
1: 0
2: 0
3: 7
4: 106
1181286493_1181286499 6 Left 1181286493 22:21756205-21756227 CCCATCACCATTTTTTGGCTCCT 0: 1
1: 0
2: 2
3: 25
4: 240
Right 1181286499 22:21756234-21756256 CAGGCACATTATGCTATCTGTGG 0: 1
1: 0
2: 0
3: 7
4: 106
1181286496_1181286499 -1 Left 1181286496 22:21756212-21756234 CCATTTTTTGGCTCCTCTATGGC 0: 1
1: 0
2: 1
3: 16
4: 187
Right 1181286499 22:21756234-21756256 CAGGCACATTATGCTATCTGTGG 0: 1
1: 0
2: 0
3: 7
4: 106
1181286494_1181286499 5 Left 1181286494 22:21756206-21756228 CCATCACCATTTTTTGGCTCCTC 0: 1
1: 0
2: 3
3: 31
4: 283
Right 1181286499 22:21756234-21756256 CAGGCACATTATGCTATCTGTGG 0: 1
1: 0
2: 0
3: 7
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181286499 Original CRISPR CAGGCACATTATGCTATCTG TGG Exonic
901444455 1:9299339-9299361 CAGCCCCAGTATGATATCTGTGG - Intronic
903375963 1:22866133-22866155 CGAGGACATTATGCTATCTGTGG + Intronic
908647801 1:66298207-66298229 TAGTCATATTATGCTGTCTGGGG + Intronic
909315183 1:74208131-74208153 AAGGCACATTCTGTTTTCTGGGG + Intronic
909368925 1:74861696-74861718 CAGGGGCATTGTGCTATGTGGGG - Intergenic
909750852 1:79158848-79158870 TAGGCACTTTATTCTTTCTGTGG + Intergenic
911287400 1:96012885-96012907 CCGGCAGATTTTGGTATCTGTGG + Intergenic
911416014 1:97575315-97575337 CAAGACCATTATGATATCTGAGG - Intronic
911648877 1:100364562-100364584 CAGCCACTTTATGAAATCTGAGG + Intronic
917964126 1:180167822-180167844 CAGGGACATGGTGCTATCTTTGG + Intronic
920039070 1:203084384-203084406 CAGGGACATTGTCCTCTCTGTGG + Intronic
921632800 1:217455449-217455471 CAGGCAGATCATTCTATCTAAGG - Intronic
922859313 1:228802477-228802499 GAGGCACAAAATCCTATCTGGGG - Intergenic
923629428 1:235640169-235640191 CAGGCACATCATGCTTACGGTGG + Intronic
924052160 1:240090333-240090355 CAGGCAAATTGTGCCCTCTGAGG + Intronic
1063488994 10:6446293-6446315 GAGGCACATTATGCTATGGAAGG - Intronic
1066652473 10:37670740-37670762 CAAGCACATTAAGATATTTGGGG - Intergenic
1070337062 10:75465251-75465273 GAGGCCCATTTTGCTTTCTGTGG + Intronic
1071162641 10:82768033-82768055 CAGTGACATTCTGGTATCTGGGG - Intronic
1074938937 10:118215921-118215943 AAAGCACATTGTGCTATCAGCGG - Intergenic
1075554278 10:123418881-123418903 CAGGAACATTGTGTTTTCTGTGG + Intergenic
1075697088 10:124444505-124444527 CAGGCACATGCTGCTATGTTTGG - Intergenic
1075837999 10:125472740-125472762 CAGTCACATTGTTCTATGTGGGG + Intergenic
1076163366 10:128263125-128263147 CAGGCCAATTAACCTATCTGGGG - Intergenic
1079977664 11:27112003-27112025 CAAGAACATAATGCCATCTGTGG + Intronic
1080314025 11:30927801-30927823 AAGGAAAATTATGCTATCTTTGG - Intronic
1086142178 11:83511649-83511671 CAGGCACTTTTTGCTATTGGAGG - Intronic
1090640342 11:128724404-128724426 CTGGCACAATAGGCTTTCTGGGG - Intronic
1093563672 12:20576083-20576105 CAGGCACATTATGGAAAATGAGG + Intronic
1093602066 12:21039468-21039490 CAAGCACATTATTCTTTCTTTGG + Intronic
1094067933 12:26381126-26381148 TAGGCACATTAATCCATCTGTGG - Intronic
1095533288 12:43216167-43216189 CAAGCATATGGTGCTATCTGAGG + Intergenic
1099896916 12:88659741-88659763 CAGGAACATTTTGCTGTCTGAGG + Intergenic
1102415898 12:112762422-112762444 CAGGCACATCAAACTATTTGTGG + Intronic
1106239402 13:27898407-27898429 CAGGGACTTTATTCTATTTGAGG + Intergenic
1106641519 13:31588777-31588799 CAGGTACTCTATACTATCTGGGG + Intergenic
1107389533 13:39949281-39949303 TAGGCACTTTATTCTTTCTGTGG - Intergenic
1109674297 13:65653743-65653765 CAGGCACATTCTGGTGTCAGAGG + Intergenic
1110489484 13:76086774-76086796 CAGGCACATGGTGCAAGCTGTGG + Intergenic
1114790550 14:25653240-25653262 CAGGCAGATTAAGATATTTGTGG - Intergenic
1119285297 14:73448831-73448853 CAGTCACATCTTGGTATCTGAGG + Intronic
1123548443 15:21357176-21357198 CAGGGAAATCAGGCTATCTGGGG - Intergenic
1125013374 15:34905259-34905281 TAGTCAGTTTATGCTATCTGTGG - Intronic
1128706244 15:69839234-69839256 TAGGCACATTATGACACCTGAGG + Intergenic
1131387438 15:92018866-92018888 CAGTCACATTATCGTAACTGAGG - Intronic
1149815012 17:59714807-59714829 CATGCACCTCATGGTATCTGTGG - Intronic
1151314471 17:73312926-73312948 CAGGAACATTCTGCTTTCTGGGG + Intergenic
1152613459 17:81327274-81327296 CAGGGACGTTATGCTAACTGAGG - Intronic
1156540509 18:37905194-37905216 CTGGCATATAATGATATCTGAGG - Intergenic
1156956662 18:42974360-42974382 CAGGAAAATTTTGCGATCTGAGG + Intronic
1159280857 18:66283478-66283500 CAGACACATTAGGCTAGATGTGG - Intergenic
930283629 2:49401179-49401201 CAGTCACATTATGATACTTGAGG + Intergenic
933439440 2:82293009-82293031 CAGGTATTTTATTCTATCTGTGG + Intergenic
935207629 2:100910321-100910343 CAGACACTTTCTGCTAACTGTGG + Intronic
936662912 2:114561737-114561759 CAGCCAAAATATGCCATCTGGGG + Intronic
938767430 2:134469622-134469644 CAGGCACATTCTGCATTCTGTGG + Intronic
946567829 2:220986862-220986884 TATGCACATTATCCTATTTGAGG - Intergenic
1170445615 20:16424358-16424380 CAGGGACATTATGCTTTTGGAGG - Intronic
1172520681 20:35563589-35563611 CAGCCACATTCTGTTATATGGGG + Intergenic
1176140602 20:63543135-63543157 CCAGCACATTCTGCTCTCTGCGG - Intronic
1181286499 22:21756234-21756256 CAGGCACATTATGCTATCTGTGG + Exonic
1182036770 22:27204781-27204803 CAGGCCCCTTATTTTATCTGAGG + Intergenic
952389592 3:32868800-32868822 CAGACACATTATCCTTTCTGTGG - Intronic
953349296 3:42202627-42202649 CAGGGACATGATGCTCTCAGTGG - Exonic
953652087 3:44815531-44815553 CAGGCACATTACTCTATGTCAGG - Intronic
958584790 3:96072353-96072375 CAGGCACAGCATGCCATCTGAGG - Intergenic
958970718 3:100607384-100607406 CAAACACATTATGTTACCTGGGG + Intergenic
959766459 3:110036139-110036161 CAGCCACACTATGCTATAGGAGG - Intergenic
959818494 3:110704054-110704076 CAGGCACATGGTGCAAGCTGTGG + Intergenic
961974529 3:131009307-131009329 CAGTCACCTTTTGGTATCTGTGG - Intronic
962394128 3:134999972-134999994 CAGGCACACAATGCACTCTGTGG + Intronic
962576954 3:136763607-136763629 CAGGCACATGGTGCATTCTGGGG - Intergenic
964660541 3:159115509-159115531 AAGGCAAATTTTACTATCTGTGG - Intronic
965029055 3:163340345-163340367 CTGGCAAATTCTTCTATCTGTGG - Intergenic
965576963 3:170227309-170227331 CAGGCACATGATGCTGTCGTAGG + Intronic
967712185 3:192722066-192722088 CAGGCACATTATTAAATGTGGGG - Intronic
970168066 4:13261105-13261127 CAGGATCATTATGCTATCCAAGG + Intergenic
971520387 4:27542129-27542151 CAGGCACATCATCTTATCTTAGG - Intergenic
975896442 4:79097995-79098017 CTGACACATTAAGCTTTCTGTGG + Intergenic
978765725 4:112403104-112403126 CAGGCACATTTTGCCATGTAGGG + Intronic
983993825 4:174157164-174157186 CATGTAGATTATGCTGTCTGAGG + Intergenic
986445866 5:7820609-7820631 AAGCCACAATATGATATCTGGGG + Exonic
988802380 5:34708783-34708805 CAGGCAACTTATTTTATCTGTGG - Intronic
988977315 5:36528064-36528086 CAGTCATGTTATGCAATCTGTGG + Intergenic
992366585 5:76097844-76097866 CAGTCACATTATTCTCTCTCTGG + Intronic
997465291 5:134084026-134084048 GGGGCAAATTATGCTATCAGCGG + Intergenic
1005218004 6:23554421-23554443 TAGGCACATGATGCAAGCTGTGG + Intergenic
1006896473 6:37474598-37474620 CCGGGACACTCTGCTATCTGTGG + Exonic
1008050604 6:46897008-46897030 TATGCACATTTTGGTATCTGAGG + Intronic
1012853875 6:104478281-104478303 CAGGCAGATTTTGGTAGCTGTGG - Intergenic
1015337632 6:132058846-132058868 CAGACCCATTCTGCTTTCTGTGG - Intergenic
1016193911 6:141307973-141307995 CAGATACATTTTGCTATCCGTGG + Intergenic
1018412976 6:163573909-163573931 AAGTCACACTATGTTATCTGTGG - Exonic
1019283167 7:210711-210733 CAGGAACACTCTGCTCTCTGCGG - Intronic
1023138565 7:37078073-37078095 CAGGCCCATGATGCTTTCAGAGG + Intronic
1027144642 7:75685864-75685886 CAGGCAGAATAAGCTATTTGTGG - Intronic
1030112283 7:106037096-106037118 CAGGCCCATTATTCTTTCAGAGG - Intergenic
1035818436 8:2565543-2565565 CAGTCAAATTCTTCTATCTGAGG - Intergenic
1036483238 8:9155772-9155794 CTGGCGCATTATGTTACCTGGGG + Intronic
1042438387 8:68795021-68795043 AATGTACATTATGCAATCTGAGG - Intronic
1044803309 8:95979126-95979148 CAGGCACATTATGAGATCCTGGG - Intergenic
1047039421 8:120976313-120976335 AAGGCCCATTATGATAACTGGGG - Intergenic
1050251822 9:3752857-3752879 CAGACACTTCATGCCATCTGGGG + Intergenic
1051140867 9:13977775-13977797 CATGCACAGAATACTATCTGTGG + Intergenic
1059457583 9:114409348-114409370 CAGGCATATAATGCAATCGGGGG + Intronic
1061855662 9:133440716-133440738 CAGGCACATTTGGATATTTGTGG - Intronic
1187889538 X:23921276-23921298 GAGGCATATTTTTCTATCTGTGG - Intronic
1187935350 X:24330653-24330675 CAGGCACATAATGGAATTTGGGG - Intergenic
1188340844 X:28999452-28999474 CAGGCACTGTATGCTTTTTGAGG + Intronic
1191859965 X:65658168-65658190 CAGCCACATTATGCTGTGAGAGG + Intronic
1194905985 X:99576664-99576686 CAGGCACTTGGTGCAATCTGTGG - Intergenic
1196502922 X:116406542-116406564 CAGGCACAAAATGCTATGGGAGG - Intergenic
1199306667 X:146275118-146275140 TAGGTACTTTATGCTTTCTGTGG + Intergenic
1201976667 Y:19856826-19856848 CAGCCAAATTAAGCTTTCTGAGG - Intergenic