ID: 1181289063

View in Genome Browser
Species Human (GRCh38)
Location 22:21776848-21776870
Sequence CAAGATTTTCAGCCTCATCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 195}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181289062_1181289063 -7 Left 1181289062 22:21776832-21776854 CCGTTCTACAAAAACTCAAGATT 0: 1
1: 0
2: 0
3: 23
4: 293
Right 1181289063 22:21776848-21776870 CAAGATTTTCAGCCTCATCAAGG 0: 1
1: 0
2: 1
3: 18
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181289063 Original CRISPR CAAGATTTTCAGCCTCATCA AGG Intronic
901548729 1:9979175-9979197 CAAAATGTTCAGGCTGATCATGG + Intronic
901874350 1:12158455-12158477 CAATTCTTTCAGCCTCATCGTGG - Intergenic
902303856 1:15522497-15522519 CAAGAGTTTGAGACTCATCTAGG + Intronic
903502161 1:23806708-23806730 CTAGAGTGTCAGCCTCATGAGGG + Intronic
903767641 1:25744891-25744913 CAATGTTTTCAGCCTCTGCAGGG + Intronic
903952442 1:27004248-27004270 TAACATATTCAGCCTCATTAGGG - Intergenic
905012657 1:34757879-34757901 GAACATTTTCACCCTCTTCATGG + Exonic
905217629 1:36420631-36420653 CATGATTTTTAGCCACATGAAGG + Intronic
905737677 1:40341220-40341242 CAAGAGTTTCAGATTTATCATGG + Intergenic
909213494 1:72854362-72854384 CAATGTTTCCAGCTTCATCAAGG + Intergenic
909668689 1:78164412-78164434 CAAAATTGTTAGCCTCATCAGGG - Intergenic
910533239 1:88265765-88265787 CAAGCTTTCCAGCCTCATCAGGG + Intergenic
910793480 1:91075029-91075051 CTAGATTGTCAGCTTCATGAGGG - Intergenic
911846637 1:102760983-102761005 CAAAACTTTCAAACTCATCAAGG + Intergenic
912141727 1:106737973-106737995 CAAGAATCTCAGCCTCCCCAAGG + Intergenic
912901268 1:113652254-113652276 CAAGAATATAAGCCTCATGAAGG + Intronic
914493158 1:148166922-148166944 CCAGATTTTCAGCCTTTTGAGGG - Intergenic
918926688 1:190795485-190795507 CAAGATTCTCACCATCCTCAGGG + Intergenic
919408820 1:197218491-197218513 CAAGATTTTTAGCCTCATTTTGG + Intergenic
919500824 1:198336468-198336490 CCAGACTGTCAGCCTCATTAGGG + Intergenic
920645792 1:207803508-207803530 CAAGTTATTTAGCCTCATTAAGG - Intergenic
920682118 1:208081314-208081336 CAAGTTTTTCAGCATCTTTAGGG - Intronic
924117999 1:240766737-240766759 AAAGAATTTCAGCTTCATCTAGG - Intergenic
1063804819 10:9626671-9626693 CAATATTGTCAGCCACATAAGGG - Intergenic
1064228010 10:13504397-13504419 CAGGATTTTCACCATCACCAAGG + Intronic
1064873053 10:19961758-19961780 CAATTTGCTCAGCCTCATCAGGG + Intronic
1067091551 10:43268090-43268112 CAAGGTCCTCAGCCTCTTCAAGG - Intergenic
1068862543 10:61862034-61862056 CAAGGTTTTCAATCTCATGATGG - Intergenic
1071863785 10:89703317-89703339 TAGGAATTTCAGCCTGATCAAGG + Intronic
1075018057 10:118925523-118925545 TAAGTTTTTCAACCTCATCCTGG + Intergenic
1075131285 10:119742054-119742076 CAAGTTCTTCAGCCTCATTCTGG + Intronic
1076507202 10:130986128-130986150 CAAGATCATCAGCCTTTTCAGGG + Intergenic
1076685555 10:132197026-132197048 CGAGATCTTCAGCATCATCCGGG + Exonic
1078487482 11:11737285-11737307 CCAGATCTTCTGCCTTATCAAGG + Intergenic
1080325658 11:31069882-31069904 CAGAATGTTCAGCCACATCATGG - Intronic
1082692387 11:56322597-56322619 AAATACTTTCATCCTCATCAGGG - Intergenic
1086258802 11:84912816-84912838 CAAAATTTTCATCCTCATGATGG - Intronic
1087311296 11:96546704-96546726 CACAATTGTCAGACTCATCAAGG + Intergenic
1087474394 11:98618422-98618444 GAAAATTTGCAGCCTGATCATGG - Intergenic
1088464709 11:110122564-110122586 TAAGATTTTCAACTTCATGATGG + Intronic
1090446588 11:126769809-126769831 CAAGATTCTACACCTCATCAGGG - Intronic
1091422133 12:350869-350891 GAAGATTTTTAATCTCATCATGG - Intronic
1091951499 12:4596603-4596625 CAGGATCTTCAGCTCCATCAGGG - Exonic
1092264074 12:6967961-6967983 CAAGGACTTCAGCCTCATCCTGG - Exonic
1093114659 12:15194606-15194628 CAAGATTTTAAGCAACACCAAGG - Intronic
1097431861 12:59518883-59518905 CAGTATTTCCAGCTTCATCAGGG + Intergenic
1098692644 12:73507613-73507635 CATAACTTTCATCCTCATCAAGG + Intergenic
1098764106 12:74462910-74462932 AAGGATTTTCAACCTAATCATGG + Intergenic
1100350608 12:93777946-93777968 CAAGGTTTTCAGCTTCAGAAAGG + Intronic
1100574699 12:95879684-95879706 CAAGATTTTCATCTACATCTTGG + Exonic
1102254755 12:111409121-111409143 CAAGAGTTCCAGCCTCCCCAGGG + Intronic
1102610517 12:114107803-114107825 CAAGATTTCTAACCACATCAGGG + Intergenic
1103147053 12:118604032-118604054 CAAGATATTCAGATCCATCAGGG + Intergenic
1105788559 13:23773702-23773724 AAAGATGTTCAGCATCATTAGGG - Intronic
1110807841 13:79778408-79778430 CAATCTTTTCAGTCTCAACACGG + Intergenic
1114677361 14:24452336-24452358 CAAAATTGTCAGACTCACCAAGG - Intergenic
1115084725 14:29500383-29500405 GAATATTTCCAGCCTCATCTAGG + Intergenic
1115263006 14:31472700-31472722 CCAGATTTTCAGGCTCATAGAGG + Intergenic
1115732375 14:36285405-36285427 CAGGGTTATCAGCCTCAACAAGG - Intergenic
1117093878 14:52277419-52277441 AAAAATATTCAGCCTAATCAAGG + Intergenic
1118431751 14:65726418-65726440 CAAGATTGTGAGCCCCACCAGGG - Intronic
1119263781 14:73252800-73252822 CAAGTTCTTGGGCCTCATCATGG - Intronic
1124465796 15:29938896-29938918 CAAGACTTTCAGCCACATGGGGG - Intronic
1129223357 15:74148579-74148601 CTGTATTTTCATCCTCATCAGGG + Intergenic
1131752042 15:95520092-95520114 CAAGCGTTTCTGCCACATCACGG - Intergenic
1133868601 16:9667349-9667371 CAACATCTCCAGTCTCATCATGG - Exonic
1133923082 16:10172085-10172107 GAAAATTTTGTGCCTCATCAAGG - Intronic
1134897349 16:17900440-17900462 GAAAATTTTCAGCCTCATCTTGG + Intergenic
1135467861 16:22702606-22702628 CAATATTATCAACCTCATAAGGG - Intergenic
1138579018 16:57927521-57927543 CTAGAATGTCAGCCTCATGAGGG + Intronic
1139696418 16:68678527-68678549 CAAGATTTTCTACAGCATCACGG + Exonic
1140262258 16:73390566-73390588 CAGGATTGTCAGACTCATTACGG + Intergenic
1143454329 17:7056342-7056364 CAAGGTCTTCATCCTCATGAAGG - Intergenic
1144617412 17:16789224-16789246 CATGATTTCCAGTCTCATTAGGG - Intronic
1144895291 17:18526458-18526480 CATGATTTCCAGTCTCATTAGGG + Exonic
1145136931 17:20417773-20417795 CATGATTTCCAGTCTCATTAGGG - Intergenic
1145301184 17:21639018-21639040 CAAGATTGTAAGCTTCATGAAGG + Intergenic
1145349118 17:22064284-22064306 CAAGATTGTAAGCTTCATGAAGG - Intergenic
1151125504 17:71839996-71840018 TTAGATTCTCAGCCTCATCCGGG - Intergenic
1159062718 18:63532889-63532911 CAAGTTTTTCAGGCTCAGAAAGG - Intergenic
1159733790 18:72067217-72067239 TAAAATTTTCAGCATAATCATGG + Intergenic
1162238902 19:9332118-9332140 AAAAATTTTCAGCCTAATAAAGG - Intronic
1162730067 19:12713099-12713121 CAAGATTTTCAGTGTATTCAGGG - Intronic
1163887800 19:19983453-19983475 CTGGATCTTCAGCCTCATCTTGG + Intergenic
1165356625 19:35308324-35308346 CACGATTTTCAGACACAGCAAGG + Intronic
1168466670 19:56607846-56607868 CAAGATCTTCAGTCTTCTCAGGG + Intronic
927448798 2:23188862-23188884 TATGATTTTCATCATCATCATGG - Intergenic
929549844 2:42883071-42883093 CAAGGTCTCCAGCTTCATCAAGG - Intergenic
932625800 2:73294851-73294873 CAAGATTCACAGCCTCCTTAAGG - Intergenic
932838056 2:75055817-75055839 CCAGAGTTTCAGACTCAGCAGGG + Intronic
938203582 2:129398240-129398262 CAATATCTCCAGCTTCATCAGGG - Intergenic
939741987 2:145919301-145919323 CCAGATTTTCTCCTTCATCATGG - Intergenic
942410903 2:175708580-175708602 CTGGAATTTCAGCCTCATCAAGG - Intergenic
942693570 2:178613218-178613240 CAAGATTTTCAGCCAACACACGG + Exonic
942935131 2:181546677-181546699 AAATATTTTCAGCCCCATAATGG + Intronic
945974041 2:216257225-216257247 CTGGATTTTGAGCTTCATCAGGG + Intergenic
947707147 2:232285471-232285493 TAAGAATGTCAGCCTCCTCAAGG - Intronic
1168985458 20:2044649-2044671 CAAGATTATCAACTTCATCTAGG - Intergenic
1171104643 20:22420986-22421008 CAAGATTTCCATCCTGATGAAGG + Intergenic
1171559084 20:26105813-26105835 CAAGATTGTAAGCTTCATGAAGG - Intergenic
1174816544 20:53692079-53692101 AGAGTTTTTCAGCCTCAACAAGG + Intergenic
1175744117 20:61441957-61441979 CAAGAGTTTCCACCTCAGCAGGG - Intronic
1178040935 21:28640304-28640326 CAAGATCTTTAGGCTCATGATGG + Intergenic
1181289063 22:21776848-21776870 CAAGATTTTCAGCCTCATCAAGG + Intronic
1182973712 22:34602508-34602530 AAAGAATTTCAGTCTCATCTAGG + Intergenic
1184910314 22:47527739-47527761 AAAGATTCTCTGCCTCATCAAGG - Intergenic
949719000 3:6966891-6966913 AAAGAGGTTAAGCCTCATCATGG - Intronic
951079748 3:18438919-18438941 CAAGCATTTCAGCCTCATCTGGG + Intronic
951832368 3:26944542-26944564 CATAATTTTCAGACTCACCAAGG + Intergenic
953078476 3:39593494-39593516 CAATGTTTTCAGAGTCATCAGGG - Intergenic
953777256 3:45830923-45830945 CAAGATTTACAGCTTGATCAAGG - Exonic
955054657 3:55444729-55444751 CAAGACTGTCAGGCTCAACATGG + Intergenic
955517954 3:59746809-59746831 AAGGATTGCCAGCCTCATCAAGG + Intergenic
956756575 3:72393853-72393875 CAAGAGTTTCAGGTTCATAAAGG - Intronic
957352906 3:79049127-79049149 CAAGATTTTTAGCTTCATTGCGG - Intronic
958167377 3:89894044-89894066 CAAGAGTTCGAGCCTCATCTGGG + Intergenic
958255366 3:91319464-91319486 CATGGTTTTCAGCTCCATCAGGG + Intergenic
959337669 3:105086706-105086728 AAGGATTATAAGCCTCATCATGG + Intergenic
960206449 3:114906308-114906330 AAAGATTTTCTACATCATCAAGG - Intronic
961934412 3:130568372-130568394 AAAGTTTCTCATCCTCATCACGG + Exonic
962261361 3:133910544-133910566 TGAGATTCTCAGCCTGATCATGG + Intergenic
962985487 3:140532060-140532082 GGAGATTTTCAGCCTTACCATGG - Intronic
964174324 3:153806930-153806952 AAGCATTTTCAGACTCATCATGG - Intergenic
964667514 3:159190406-159190428 CGAGATTTACAGTCTCATTAGGG + Intronic
973027913 4:45296228-45296250 TAAAATTTTCAGCCTCATATTGG - Intergenic
974562445 4:63539489-63539511 AGAGATATTCAGACTCATCATGG - Intergenic
975449443 4:74507009-74507031 CAAGATTGTCAGCTTCACCAAGG + Intergenic
978049389 4:104177820-104177842 AAAAATTCTCAACCTCATCAGGG + Intergenic
978547685 4:109890266-109890288 CTAGATTTTCTCTCTCATCATGG + Intergenic
978665002 4:111172178-111172200 CAACATCCTCAGCTTCATCAGGG - Intergenic
979601418 4:122590204-122590226 AAAGGTTTTCATCCTCATAAAGG - Intergenic
982422837 4:155217899-155217921 CTAGATTTTAAGCATCATGAGGG + Intergenic
982994963 4:162331492-162331514 TAAAATTTTCAGCTTCTTCAAGG - Intergenic
984169177 4:176340999-176341021 GAAGACTTTCCGCCTCATAAAGG - Intergenic
984617198 4:181912306-181912328 CTAGATTTTAAGCATCATGAGGG - Intergenic
985095649 4:186410096-186410118 AAAGAATTCCAGCCTCATCTTGG - Intergenic
985926850 5:3025814-3025836 CAAGATTTTTAACTTAATCATGG + Intergenic
986431168 5:7682622-7682644 CCACAGTTTCAGCATCATCAGGG + Intronic
987636278 5:20545861-20545883 GAAAATTTGCAGCCTGATCATGG - Intronic
989416196 5:41179146-41179168 CAAAATTGTTAGCCTCACCAGGG - Intronic
990721203 5:58698376-58698398 CAAAATTTTCAGATTCACCAAGG - Intronic
991076753 5:62548290-62548312 CAATATGTTCAGACACATCAAGG + Intronic
991329148 5:65473625-65473647 CTGGATTTTGAGCCTCATCATGG - Exonic
993194941 5:84730084-84730106 CTGGATTTTCAGCCTTATGAAGG + Intergenic
993621542 5:90174062-90174084 TAAGATTTTCAGTCTAATCATGG - Intergenic
994763867 5:103891868-103891890 GAAGACATTCTGCCTCATCAAGG + Intergenic
1000358015 5:160419367-160419389 CAAGAGCTTAAGCCTCACCAGGG + Exonic
1003130162 6:3388733-3388755 CAAGATTTTCTTCCTTCTCAAGG - Intronic
1003431598 6:6043590-6043612 CAAGATATCCAGTCTCCTCATGG - Intergenic
1008403029 6:51086178-51086200 ACATATTTTCAGCCTCATCTTGG + Intergenic
1008711619 6:54234529-54234551 ATAGATTTGCAGCATCATCAAGG - Intronic
1008832818 6:55789025-55789047 CATAATTTTCAACCACATCAAGG - Intronic
1011554341 6:88558903-88558925 CAAGATTTCAAGGGTCATCATGG + Intergenic
1012645500 6:101674056-101674078 CAAGATTCTCAACTTCATAAAGG - Intronic
1013342724 6:109230763-109230785 CAACATTGTCAGCTTCACCAAGG - Intergenic
1013641740 6:112089942-112089964 CAAGACATGCAGCCTCATTAAGG + Intronic
1013894121 6:115064473-115064495 CAAGATTATCAGCCTTACCGTGG + Intergenic
1014961357 6:127689322-127689344 AAAGATTCTCAGCCTCATAGTGG - Intergenic
1015162839 6:130172657-130172679 CATGATTGTCAGACTCACCAGGG - Intronic
1017812597 6:157994837-157994859 CAATATTTTCAACATCCTCATGG - Intronic
1018382710 6:163273520-163273542 TTAGATTTTCTGCCTCTTCAAGG + Intronic
1019928430 7:4208166-4208188 CAGGTTCTTCAGCCTCACCACGG - Exonic
1020379578 7:7528593-7528615 AATGATTTTCAAACTCATCAGGG - Intronic
1022171073 7:27832155-27832177 CAAGATTTTCAGCTTTTTAAAGG + Exonic
1022990649 7:35703932-35703954 CAAGATTGTCAGCATCATCTGGG - Intergenic
1023271693 7:38470029-38470051 CAGGATGTTCAACCTGATCAAGG - Intronic
1025278599 7:57607752-57607774 CAAGATTATAAGCTTCATGAAGG + Intergenic
1026275024 7:68869150-68869172 CTAGAATTACAGCCTCAACAGGG + Intergenic
1027123208 7:75537170-75537192 CAAGTTTTTGAGCCTCGTCACGG + Exonic
1027647889 7:80827260-80827282 CAAGAGTTCCAGTCTCCTCAAGG + Intronic
1028367919 7:90055941-90055963 CAAGATTTTCAGTCTCACCCAGG + Intergenic
1031152055 7:118065480-118065502 CAAGTTTGTCAGGCTCATGAAGG + Intergenic
1032008511 7:128324619-128324641 GAAGCTTTGCAGCCTCATCACGG + Exonic
1032511336 7:132475076-132475098 CAAGATTTTAAGCCACACCCAGG + Intronic
1032780248 7:135159530-135159552 CAAGAGTTACAGCCTGAGCAGGG - Intronic
1036159580 8:6374243-6374265 CTAGATTTTCAGTATCACCAAGG + Intergenic
1036429538 8:8677228-8677250 CAAGATTTCAAGACTTATCAAGG + Intergenic
1038448456 8:27621204-27621226 AAATATGTTCAGCCTCACCATGG - Intergenic
1041381495 8:57258325-57258347 CCAGATGCTCAGCCTCATCCTGG + Intergenic
1043844735 8:85151377-85151399 CATAATTTTCAGACTCACCAAGG + Intergenic
1044172754 8:89075926-89075948 CATGATTTTCTTCCTCTTCATGG - Intergenic
1044792446 8:95861940-95861962 ACAGACTTTCAGCCTCATCCTGG + Intergenic
1048888598 8:138928751-138928773 AATGATTGTCAGCCTCATGAAGG + Intergenic
1049129955 8:140829871-140829893 CAAGATTTTCAAGCGCAGCAGGG - Intronic
1050616587 9:7407609-7407631 CAAGCTTTTCATCCACGTCAAGG - Intergenic
1051848616 9:21481415-21481437 GCAGATCTTCAGCCTCTTCAGGG - Exonic
1052096409 9:24389926-24389948 CAAGATTGTCAGATTCACCAAGG - Intergenic
1056216576 9:84410518-84410540 CCAGATTTTCAGCAAAATCAAGG - Intergenic
1056521152 9:87402713-87402735 TCAGATTTTCAGCCTTAACATGG - Intergenic
1057226277 9:93294908-93294930 GAAGATTTTCAGCCTCAACTGGG + Intronic
1057797820 9:98171115-98171137 CCAGATTTTCAGCCTCCTGGAGG - Intronic
1058606041 9:106724354-106724376 AAATATTTTCAGTCCCATCAAGG - Intergenic
1062647266 9:137554856-137554878 GAACATTTTATGCCTCATCATGG - Intergenic
1186122656 X:6380726-6380748 GAAGATTTTCAGGGTCTTCATGG + Intergenic
1186169460 X:6861583-6861605 CAAGATTTTCAAGCTGATCTTGG - Intergenic
1187217531 X:17291360-17291382 CAAGATTTAGAGCCTCAATATGG + Intergenic
1187361189 X:18628857-18628879 CAATATTTTCAGCTTTATGAAGG + Intronic
1187496144 X:19797443-19797465 CTACCTTTTCAGCCTCATCGGGG - Intronic
1188068214 X:25687382-25687404 CTAGATTTTGAGCTTCTTCAAGG + Intergenic
1190358382 X:49626860-49626882 CAAGAATTTCCGCTCCATCAAGG - Intergenic
1192608280 X:72542541-72542563 CCAGATTTCCAGCAGCATCATGG - Intronic
1193022411 X:76804470-76804492 CATGATTTTCAGTCTCATGAAGG + Intergenic
1194339878 X:92694571-92694593 GAAAATTTGCAGCCTGATCATGG - Intergenic
1194666143 X:96679608-96679630 CAAGATTTTAGGCCTAATGATGG + Intergenic
1194820453 X:98500047-98500069 CTAGATTTTAAGCTTCATGAAGG - Intergenic
1195115491 X:101694278-101694300 GAAGATTTTCAGTGTCCTCATGG + Intergenic
1195955892 X:110330059-110330081 TATGATTTTCAGCCTCAGCTGGG + Intronic
1196405066 X:115352645-115352667 GCAGATTTTCATCCACATCATGG - Intergenic
1196677422 X:118434728-118434750 CAAGATTCTAAGCCTCTCCAGGG + Intronic
1197198577 X:123729029-123729051 CAAGTTTATTAGCTTCATCATGG + Intronic
1198150934 X:133908580-133908602 CATGATTTTCAGACCCATCCTGG + Intronic
1199565317 X:149209501-149209523 CAAAATTTTGAGCTTCCTCATGG - Intergenic
1199844573 X:151681412-151681434 CATGATCTTCAGCCTCACCAAGG + Intergenic
1200363838 X:155639542-155639564 CAAGATTTTCTTCCTCTTTAAGG + Intronic
1200893421 Y:8347745-8347767 CAAGATTGTCAGACTATTCATGG + Intergenic