ID: 1181291536

View in Genome Browser
Species Human (GRCh38)
Location 22:21798190-21798212
Sequence CTATATCAGCTGAGGTAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 112}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181291529_1181291536 4 Left 1181291529 22:21798163-21798185 CCCCCTCCTACTCTACAACCGTC 0: 1
1: 0
2: 1
3: 18
4: 701
Right 1181291536 22:21798190-21798212 CTATATCAGCTGAGGTAGAGAGG 0: 1
1: 0
2: 0
3: 9
4: 112
1181291531_1181291536 2 Left 1181291531 22:21798165-21798187 CCCTCCTACTCTACAACCGTCAG 0: 1
1: 0
2: 1
3: 10
4: 72
Right 1181291536 22:21798190-21798212 CTATATCAGCTGAGGTAGAGAGG 0: 1
1: 0
2: 0
3: 9
4: 112
1181291532_1181291536 1 Left 1181291532 22:21798166-21798188 CCTCCTACTCTACAACCGTCAGC 0: 1
1: 0
2: 1
3: 12
4: 96
Right 1181291536 22:21798190-21798212 CTATATCAGCTGAGGTAGAGAGG 0: 1
1: 0
2: 0
3: 9
4: 112
1181291533_1181291536 -2 Left 1181291533 22:21798169-21798191 CCTACTCTACAACCGTCAGCACT 0: 1
1: 0
2: 0
3: 8
4: 74
Right 1181291536 22:21798190-21798212 CTATATCAGCTGAGGTAGAGAGG 0: 1
1: 0
2: 0
3: 9
4: 112
1181291530_1181291536 3 Left 1181291530 22:21798164-21798186 CCCCTCCTACTCTACAACCGTCA 0: 1
1: 0
2: 1
3: 5
4: 97
Right 1181291536 22:21798190-21798212 CTATATCAGCTGAGGTAGAGAGG 0: 1
1: 0
2: 0
3: 9
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181291536 Original CRISPR CTATATCAGCTGAGGTAGAG AGG Intronic
906721170 1:48005903-48005925 CTCCATCAGCTGAGATAGGGAGG + Intergenic
923406086 1:233662169-233662191 GTATCTCTGCTGAGGTGGAGAGG + Intronic
923469208 1:234275525-234275547 CTACATCAGCTGAGATAGATAGG + Intronic
924294674 1:242573944-242573966 CTATCTCAGAGGAGGCAGAGAGG + Intergenic
1063275936 10:4568036-4568058 CTATAACAGCAGCAGTAGAGGGG + Intergenic
1067261017 10:44691488-44691510 ATTTAACACCTGAGGTAGAGGGG - Intergenic
1067706822 10:48612242-48612264 CTATAACAGATGAGGTGAAGAGG - Intronic
1069389901 10:67923664-67923686 CTCCAGAAGCTGAGGTAGAGAGG - Intronic
1070548413 10:77470881-77470903 CTATGCCAGCTGAGGCAGTGAGG + Intronic
1078581513 11:12542792-12542814 CTTTATTAGCTGAGGTACACGGG - Intergenic
1078970656 11:16407225-16407247 CTATATCTGCTGTTGTAAAGGGG - Intronic
1081657987 11:44869912-44869934 GTATAACAGCTCAGGTGGAGAGG + Intronic
1081927178 11:46840692-46840714 CTATATAGGGTGAGGTATAGGGG - Intronic
1082839774 11:57679523-57679545 CTATACCATCTCAGGTAGAACGG - Intronic
1087136006 11:94720789-94720811 CTTGATCAGCTGGGCTAGAGAGG + Intronic
1089444994 11:118544857-118544879 CCATCTCAGCTGGGGCAGAGGGG + Exonic
1090468249 11:126954992-126955014 CTAGCTCAGCTGAGGCTGAGAGG + Intronic
1091082064 11:132680602-132680624 CAATTACAGCTGAGGTAGCGTGG - Intronic
1091591831 12:1846932-1846954 CTAGATCTGCCGAGGCAGAGAGG - Intronic
1091595225 12:1873954-1873976 CTCTTTCAGCTGAGGCAGATGGG + Intronic
1093906508 12:24699129-24699151 GGATATTAGCTGAGGTTGAGAGG - Intergenic
1098245830 12:68516833-68516855 CTAAACCTGCAGAGGTAGAGTGG - Intergenic
1098878248 12:75889553-75889575 TTCAATCAGCTGAGGAAGAGAGG + Intergenic
1099466706 12:82997090-82997112 CCATATCAGCAGAGAGAGAGTGG - Intronic
1107005491 13:35604917-35604939 CAATAGCAGCTGAGGAAGAAGGG - Intronic
1107908354 13:45082657-45082679 CTTGATCATCTCAGGTAGAGGGG + Intergenic
1108106225 13:47013689-47013711 CTGTATCAGCTGAAGGAGATGGG + Intergenic
1114601031 14:23955531-23955553 CTCTATAAGCTGAAGAAGAGGGG - Intronic
1114605242 14:23990678-23990700 CTCTATAAGCTGAAGAAGAGGGG - Intronic
1117479492 14:56128924-56128946 CTATGTCAGCAGAGGTAGAAAGG + Intronic
1120206482 14:81592087-81592109 TTATATCTACAGAGGTAGAGAGG - Intergenic
1120460375 14:84787321-84787343 GTATATCTGCTGAGGAAAAGGGG - Intergenic
1125925993 15:43563678-43563700 TTATATCAGCTGAGGAATTGGGG + Intronic
1125939137 15:43663229-43663251 TTATATCAGCTGAGGAATTGGGG + Intronic
1131851265 15:96545980-96546002 TTATATGAGGTGAGGTACAGTGG + Intergenic
1132311110 15:100858631-100858653 CTAGAACAGCTGGGGTAGACAGG - Intergenic
1133430065 16:5728920-5728942 CACTATCAGTTGAGGTTGAGAGG - Intergenic
1135557816 16:23451770-23451792 TTATTTCAGCTGAGGAAGATAGG - Intronic
1136922168 16:34342376-34342398 CCATATCATTTGAGGTTGAGGGG - Intergenic
1136982405 16:35069430-35069452 CCATATCATTTGAGGTTGAGGGG + Intergenic
1137477472 16:48821945-48821967 CTATAGCAGATGAGGGAGAGGGG + Intergenic
1138833113 16:60400173-60400195 CAAAATCAGATGAGGGAGAGAGG - Intergenic
1139258489 16:65567160-65567182 CTATATCAGCTTAGGTAATTTGG + Intergenic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1143125977 17:4641121-4641143 CTTTATCACCTGGGGTGGAGTGG - Intronic
1143402505 17:6655702-6655724 CTTTATCACCTGGGGTGGAGTGG + Intergenic
1144765408 17:17729883-17729905 CTATGTTAGCAAAGGTAGAGTGG + Intronic
1155576000 18:27247669-27247691 CTATATCAGTTGGGGTAAAGCGG - Intergenic
1156190162 18:34709623-34709645 CTATATTTGCTGAGGTGGGGAGG - Intronic
1156474617 18:37397776-37397798 CAGTCTCAGCTGGGGTAGAGTGG + Intronic
1156889494 18:42174395-42174417 CTATGTAAGCAGAGGTATAGAGG - Intergenic
1157189279 18:45567283-45567305 CTATCTCAGCTTAGGAAGGGTGG - Intronic
1158733551 18:60053892-60053914 CGGTATCAGCTGAGATGGAGCGG - Intergenic
1164909655 19:31995721-31995743 CTATATAAACTGATGTTGAGTGG + Intergenic
926542992 2:14204428-14204450 CTATAACAGCTGGGCGAGAGAGG + Intergenic
927011016 2:18904374-18904396 CTTTATCAGCCGAGTTATAGAGG + Intergenic
927282164 2:21318345-21318367 CTACATCAGCAGAGTTGGAGGGG - Intergenic
927629454 2:24759709-24759731 CTATATCACCTCATGTATAGAGG + Intronic
932053352 2:68420476-68420498 CTAAATCAGCTGAGATAGCTAGG - Intergenic
933825159 2:86153151-86153173 CTATATAAGCTGAGGAGGAGTGG + Intronic
942648110 2:178136615-178136637 CTAAATCAGCTGATGTGCAGAGG - Intronic
944562782 2:200957691-200957713 CTATATAAACTGTGGAAGAGTGG - Intronic
944897532 2:204180297-204180319 CTTTATCCTCTGAGGTAAAGTGG - Intergenic
946206892 2:218116063-218116085 CCATATCATTTGAGGTTGAGGGG - Intergenic
948027662 2:234790862-234790884 CTATAGCAGTTGGGCTAGAGAGG + Intergenic
1169793993 20:9441765-9441787 CTAGAAGAGCTGATGTAGAGAGG + Intronic
1170045440 20:12080403-12080425 CTAAATCCACTGAGGGAGAGGGG - Intergenic
1170715488 20:18827633-18827655 CTTTATAAGCAGAGGAAGAGAGG + Intronic
1173392877 20:42650478-42650500 CTCAATCAGCTGCAGTAGAGGGG + Intronic
1177528320 21:22327731-22327753 CTATATGAGCTGAGGAAAATCGG - Intergenic
1178127798 21:29534256-29534278 CCATAGCTGCTGAGATAGAGGGG + Intronic
1181291536 22:21798190-21798212 CTATATCAGCTGAGGTAGAGAGG + Intronic
1181444200 22:22956303-22956325 CTGTGGCAGCTGGGGTAGAGTGG + Intergenic
1184114123 22:42412351-42412373 GTATATTAGGAGAGGTAGAGTGG - Intronic
950157720 3:10736223-10736245 TTATCTCAGCTGAGCTTGAGGGG + Intergenic
956611858 3:71132000-71132022 CTGGACCAGCTGAGTTAGAGAGG - Intronic
957246297 3:77721019-77721041 CTAGATCACCTGGGGGAGAGAGG + Intergenic
962028618 3:131574826-131574848 CTAGACCACCTGAGGTTGAGTGG + Intronic
965340890 3:167489711-167489733 CTATATCAGCTGAACAACAGTGG + Intronic
967528187 3:190518169-190518191 CTGTAGCAGCTGTGGTAGTGTGG + Intronic
967562497 3:190933405-190933427 CTATTCCATCTGAGGTAGACAGG - Intergenic
970662805 4:18305211-18305233 CTACACCAGATGAGGTAGAAGGG - Intergenic
976671738 4:87661800-87661822 CTATTTAAGCTCTGGTAGAGAGG + Intronic
979339872 4:119509823-119509845 CTCTCTTACCTGAGGTAGAGGGG - Intronic
979955370 4:126947652-126947674 CTAGATCAGCAGAAGTATAGAGG - Intergenic
982389674 4:154850825-154850847 ACATAGCAACTGAGGTAGAGGGG + Intergenic
986646821 5:9924985-9925007 CAAGCTCAGCTGAGGTTGAGGGG + Intergenic
986722576 5:10570293-10570315 CTATCTCAGCTGATGTAGGCTGG + Intronic
987205160 5:15617997-15618019 CTATATCAGCTGTGTTGCAGGGG + Intronic
987362057 5:17116348-17116370 TTTTCTCTGCTGAGGTAGAGAGG - Intronic
987414365 5:17647685-17647707 CTATCTAAGCTGAGGTCCAGAGG + Intergenic
989652187 5:43703841-43703863 CTAAAACAGATGAGGTTGAGTGG - Intronic
994092154 5:95818973-95818995 CTATAGGAGCTGAGGGAGATGGG - Intronic
1004310265 6:14539406-14539428 CTATATAAAATGAGATAGAGAGG - Intergenic
1005437266 6:25827993-25828015 CTAAATCAGGTGTGGAAGAGGGG + Intronic
1006951753 6:37828024-37828046 TTATTTCTGCTGAAGTAGAGTGG + Intronic
1007859444 6:44892283-44892305 CTTTATAAGATGAGGAAGAGAGG + Intronic
1011278869 6:85656877-85656899 TTATATAAGTTGAGGTAGAAGGG - Intergenic
1014319537 6:119909426-119909448 CTAAATTAGCAGAGGTAGAAGGG - Intergenic
1016794532 6:148103923-148103945 CTTTTTCATGTGAGGTAGAGGGG - Intergenic
1022600592 7:31755348-31755370 CTCTATCAGCTGAAGGGGAGGGG + Intronic
1026543423 7:71300417-71300439 CCATTTCAGCTGTGGCAGAGAGG - Intronic
1028270305 7:88779965-88779987 CAATCTCAGCTGATTTAGAGTGG + Intronic
1030772001 7:113486671-113486693 CTATTTCAGCAGATGTAGAGAGG + Intergenic
1036235989 8:7039964-7039986 CTATAGGAGCTGGGGTAGAGAGG + Intergenic
1037004460 8:13759899-13759921 CTACATCAGCTAAGGTACAGTGG - Intergenic
1039195979 8:35032091-35032113 CCAGATCATATGAGGTAGAGGGG + Intergenic
1042193345 8:66210362-66210384 CTACATCAGCTGGGGCAGAGGGG - Intergenic
1048823594 8:138401628-138401650 CTATGTCAGCTGAGGTTAAAAGG - Intronic
1050615454 9:7397159-7397181 CTATAGGAGATGAGGCAGAGTGG + Intergenic
1050711863 9:8474443-8474465 AGATTTCAGCTAAGGTAGAGTGG - Intronic
1052347273 9:27422432-27422454 CTATATCAACAGAATTAGAGAGG - Intronic
1052591996 9:30509834-30509856 CTATCTAAGCTGAAATAGAGAGG + Intergenic
1054811994 9:69442331-69442353 CTATAAGAGCTGAGGCAGCGGGG + Intronic
1186361914 X:8851188-8851210 CTAGATCAGCTCAGGTAGCAAGG + Intergenic
1188162599 X:26821473-26821495 CTGTTTCAGCTTAGGTACAGGGG + Intergenic
1191843394 X:65528862-65528884 CTAAATCAGGTGAGCTGGAGGGG - Intronic
1193538560 X:82742759-82742781 CAACAACAACTGAGGTAGAGAGG - Intergenic
1196184548 X:112731793-112731815 CAATATCAACTGCTGTAGAGAGG + Intergenic
1197178453 X:123509379-123509401 CTATGTCAGCTGATGTTGAAGGG - Intergenic
1198447421 X:136731355-136731377 GTATTTCAGCTGAGGTGGTGAGG + Intronic
1199027417 X:142956492-142956514 CCCTCTCAGCTGTGGTAGAGGGG - Intergenic