ID: 1181295504

View in Genome Browser
Species Human (GRCh38)
Location 22:21835201-21835223
Sequence GAGGCTGAACTGAGGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1240
Summary {0: 1, 1: 1, 2: 7, 3: 119, 4: 1112}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181295497_1181295504 -2 Left 1181295497 22:21835180-21835202 CCTGTAGTCCCAGCTACTCGAGA 0: 1765
1: 64073
2: 190232
3: 271081
4: 186782
Right 1181295504 22:21835201-21835223 GAGGCTGAACTGAGGGAGGAAGG 0: 1
1: 1
2: 7
3: 119
4: 1112
1181295496_1181295504 2 Left 1181295496 22:21835176-21835198 CCTGCCTGTAGTCCCAGCTACTC 0: 459
1: 1876
2: 2814
3: 2405
4: 1893
Right 1181295504 22:21835201-21835223 GAGGCTGAACTGAGGGAGGAAGG 0: 1
1: 1
2: 7
3: 119
4: 1112
1181295499_1181295504 -10 Left 1181295499 22:21835188-21835210 CCCAGCTACTCGAGAGGCTGAAC 0: 5
1: 284
2: 10387
3: 144244
4: 327392
Right 1181295504 22:21835201-21835223 GAGGCTGAACTGAGGGAGGAAGG 0: 1
1: 1
2: 7
3: 119
4: 1112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181295504 Original CRISPR GAGGCTGAACTGAGGGAGGA AGG Intronic
900101546 1:964228-964250 GTGGGTAAACAGAGGGAGGAGGG - Intronic
900167075 1:1248105-1248127 GAGGCTGGACTGAGGGAGGCTGG + Intergenic
900167092 1:1248171-1248193 GAGGCTGGACCGAGGGAGGCTGG + Intergenic
900167114 1:1248237-1248259 GAGGCTAGACCGAGGGAGGCTGG + Intergenic
900167135 1:1248302-1248324 GAGGCTGTACCGAGGGAGGCTGG + Intergenic
900167158 1:1248368-1248390 GAGGCTGGACCAAGGGAGGCTGG + Intergenic
900167176 1:1248434-1248456 GAGGCTGGACCGAGGGAGGCTGG + Intergenic
900167197 1:1248500-1248522 GAGGCTAGACCGAGGGAGGCTGG + Intergenic
900167218 1:1248566-1248588 GAGGCTGGACCAAGGGAGGCTGG + Intergenic
900167236 1:1248632-1248654 GAGGCTGGACCGAGGGAGGCTGG + Intergenic
900167280 1:1248764-1248786 GAGGCTAGACCGAGGGAGGCTGG + Intergenic
900167301 1:1248830-1248852 GAGGCTGGACCGAGGGAGGCTGG + Intergenic
900167320 1:1248896-1248918 GAGGCTGGAGCGAGGGAGGCTGG + Intergenic
900167343 1:1248962-1248984 GAGGCTGGAGCGAGGGAGGCTGG + Intergenic
900167366 1:1249028-1249050 GAGGCTGGAGCGAGGGAGGCTGG + Intergenic
900167389 1:1249094-1249116 GAGGCTGGACCGAGGGAGGCTGG + Intergenic
900167413 1:1249160-1249182 GAGGCTGGACCGAGGGAGGCTGG + Intergenic
900167437 1:1249226-1249248 GAGGCTGGACCGAGGGAGGCTGG + Intergenic
900167461 1:1249292-1249314 GAGGCTGGACCGAGGGAGGCTGG + Intergenic
900167485 1:1249358-1249380 GAGGCTGGACCGAGGGAGGCTGG + Intergenic
900167509 1:1249424-1249446 GAGGCTGGACCGAGGGAGGCTGG + Intergenic
900167533 1:1249490-1249512 GAGGCTGGACCGAGGGAGGCTGG + Intergenic
900167557 1:1249556-1249578 GAGGCTGGACCGAGGGAGGCTGG + Intergenic
900167580 1:1249622-1249644 GAGGCTAGACCGAGGGAGGCTGG + Intergenic
900329198 1:2125705-2125727 GAGGCTGGAGTGTGGGCGGAGGG + Intronic
900402329 1:2477667-2477689 GAGGCTGAATGGAGAGAGGAGGG + Intronic
900415903 1:2534548-2534570 CAGGCTGACCTGGGGAAGGAGGG + Intergenic
900440313 1:2651757-2651779 GATGCTCATCTGAGGGTGGAGGG - Intronic
900498748 1:2989373-2989395 GAGGATGAATAGATGGAGGATGG - Intergenic
900711308 1:4116323-4116345 GAGGCAGAGCTCAGGCAGGAAGG + Intergenic
900973616 1:6004958-6004980 GGAGCTGAGCTGAGGGATGAGGG + Intronic
900973638 1:6005037-6005059 GGGGCTGAGCTGAGGGGTGAGGG + Intronic
900973648 1:6005076-6005098 GAAGCTGAGCTGAGGGGTGAGGG + Intronic
900973718 1:6005315-6005337 GAAGCTGAGCTGAGGGGTGAGGG + Intronic
900973734 1:6005373-6005395 GAGGGTGAACTGGGGGATGTGGG + Intronic
900974438 1:6008300-6008322 GAGGATGAACAGAGGAACGAGGG - Intronic
900999516 1:6141800-6141822 GAGGCTGGAAGGAGGAAGGAAGG + Intronic
901672305 1:10863007-10863029 TATGCTGAACCGAGGCAGGAGGG + Intergenic
901751778 1:11414388-11414410 GAGGCAGAGCTGGGGGATGAGGG + Intergenic
901933156 1:12609785-12609807 GAGGAAGAACTGAGGGAGACAGG - Intronic
901933447 1:12612185-12612207 CAGGCTGCACAGAGTGAGGATGG + Intronic
902317809 1:15636535-15636557 GAGGCTGCAGTGAGCTAGGATGG - Intronic
902490625 1:16778250-16778272 GAGAGTGGACTGAGGGATGAGGG + Intronic
902562193 1:17284515-17284537 GAGGTTGCACTGTGGAAGGATGG + Intergenic
902613694 1:17612084-17612106 GAGAATGAATGGAGGGAGGATGG - Intronic
902672393 1:17983810-17983832 GAAGCAGAACTGAAGGAGCAGGG - Intergenic
902799098 1:18818419-18818441 GAGGGGGAGCTGAGGGAGGTGGG + Intergenic
902841162 1:19074767-19074789 GAGGGAGAACAGAGGGTGGAAGG + Exonic
903091703 1:20925596-20925618 GAGGCTGCAGTGAGGTATGATGG - Intronic
903699175 1:25233405-25233427 GAGGCTGGCCTCAGGGAAGAAGG - Intergenic
903702009 1:25256217-25256239 GAGGCTGCAGTGAGCTAGGATGG - Intronic
903819184 1:26088099-26088121 GAGGCTGAAGTGAGCTATGATGG + Intergenic
904255978 1:29255151-29255173 GGGCCTGAAGAGAGGGAGGAGGG + Intronic
904285966 1:29453480-29453502 GAGACAGAAAGGAGGGAGGAGGG + Intergenic
904437348 1:30507435-30507457 GAGGTTGCACAGAGGAAGGAGGG - Intergenic
904477764 1:30775826-30775848 GGAGCTGAACTGAGGAGGGAGGG + Intergenic
904592964 1:31625470-31625492 GAGTCAGACCTGTGGGAGGAGGG + Intronic
904771644 1:32884495-32884517 GAGGCTGAACTGGGGAAGTGGGG + Intergenic
905120215 1:35676062-35676084 GAGGAAGAAGAGAGGGAGGAAGG - Intergenic
905630271 1:39514651-39514673 GAGGCTCCACTGGGGCAGGAGGG + Intronic
905651039 1:39657164-39657186 GAGGCTGGTCCCAGGGAGGAAGG - Intergenic
905667489 1:39771539-39771561 GAGGCTCCACTGGGGCAGGAGGG - Intronic
905800010 1:40837503-40837525 GAGGCTGAGTTGAGGGTGGAGGG - Intronic
905824109 1:41016295-41016317 GGGGCCAAACTGAGGGAGGAAGG + Intronic
906248078 1:44291028-44291050 GAGGATGCAGTGGGGGAGGAAGG - Intronic
906460074 1:46030167-46030189 GAGGAAGAAGTGAGTGAGGATGG + Exonic
906608188 1:47185344-47185366 GAGGCTGAACTGAGGGCGTCTGG - Intronic
906689684 1:47784414-47784436 GGGGCTGGGCAGAGGGAGGAGGG + Intronic
907050404 1:51326241-51326263 GAGGCTGGGCGGAAGGAGGATGG + Intronic
907204152 1:52754088-52754110 GAGGTTGCAGTGAGGCAGGATGG - Intronic
907383795 1:54112298-54112320 GAGGCTGCAGTGAGCTAGGATGG + Intronic
907491478 1:54811590-54811612 GAGGCTGAACTTGGAGATGAAGG + Intronic
907561432 1:55393067-55393089 GAGGGTGAAGGGTGGGAGGAGGG - Intergenic
907578611 1:55551485-55551507 GAGGGTGAAGGGTGGGAGGAGGG - Intergenic
907767931 1:57428975-57428997 GAGGCTGAACTAAGCAATGATGG - Intronic
907839820 1:58145932-58145954 GAGGCTGAGGAGAAGGAGGAGGG - Intronic
908210067 1:61891094-61891116 GAGGCTGATGTCTGGGAGGATGG + Intronic
908362221 1:63380372-63380394 GTGGCTGAAGTGGGGGAAGAAGG + Intronic
908517454 1:64907537-64907559 GAGGGTGAAGGGTGGGAGGAGGG + Intronic
908584706 1:65555007-65555029 GAGGGTGAGCTGAAGCAGGATGG - Intronic
908863002 1:68511242-68511264 GAGGGTGAAGGGTGGGAGGAGGG + Intergenic
909060670 1:70875614-70875636 GAGGCTGGAGGGTGGGAGGAAGG - Intronic
909695131 1:78459636-78459658 GAGGGTGAAAGGTGGGAGGAGGG - Intronic
910564216 1:88625170-88625192 GAGGCTCAAGGGTGGGAGGAGGG + Intergenic
910813325 1:91260366-91260388 GAGGGTGGACAGTGGGAGGAGGG + Intergenic
910891432 1:92024436-92024458 GAGGGAGAAGAGAGGGAGGAGGG + Intergenic
910989032 1:93035915-93035937 GAGTGGGAACTGAGGAAGGATGG + Intergenic
911429214 1:97762005-97762027 GAGGGTGGACAGTGGGAGGAGGG + Intronic
912271196 1:108210516-108210538 GAGTCAGAACTCAGGAAGGAAGG + Intergenic
912516643 1:110220478-110220500 GAGGGTGAGCAGAGGGAGGGAGG - Intronic
912798073 1:112704915-112704937 TGAGCTGGACTGAGGGAGGAAGG - Intronic
912938451 1:114024078-114024100 GAGAATGAGGTGAGGGAGGAGGG + Intergenic
913217075 1:116629573-116629595 GAGCCTGAAGTGGGGGAGGGGGG + Intronic
913360348 1:117973823-117973845 GACTCTGAAAGGAGGGAGGAAGG - Intronic
915081326 1:153354660-153354682 GAGGTTGGACTGAGGGATGGTGG - Intergenic
915268240 1:154733814-154733836 GGGGATGAAGGGAGGGAGGAAGG - Intronic
915286528 1:154856877-154856899 GAGACAGATATGAGGGAGGATGG + Intronic
915307600 1:154989608-154989630 GAGGCTGTACTGAGCCAGGGAGG - Exonic
915385254 1:155485421-155485443 AAGGCTGAGCGGGGGGAGGATGG - Intronic
915680858 1:157580994-157581016 GAGGCTGACCTGAGGAGAGAGGG + Intronic
915932389 1:160068601-160068623 GAGGAAGAAACGAGGGAGGAGGG - Intronic
916055248 1:161064690-161064712 GAGGCTGCAGTGAGTGATGATGG + Intronic
916079751 1:161225122-161225144 GAGGGTGAAGGGTGGGAGGAGGG - Intergenic
916742443 1:167658181-167658203 GAGGCTGGACACAGGGAGGGGGG - Intronic
916873466 1:168942244-168942266 GAGGCTAATCTGAGGGAGGCTGG - Intergenic
917964556 1:180170090-180170112 GAGGCAGAGCTGGGGGAGGAGGG + Intronic
917990155 1:180367525-180367547 GAGGGTGAAGGGTGGGAGGAGGG - Intronic
918158892 1:181878648-181878670 GAGGGTGGAGTGTGGGAGGAGGG - Intergenic
918539033 1:185606989-185607011 GAGGCTGTAGTGAGCTAGGATGG + Intergenic
918866143 1:189903162-189903184 GAGGGTGAAGGGTGGGAGGAGGG - Intergenic
919190575 1:194212170-194212192 GAGGCCTAACTGAGGGTGGAAGG + Intergenic
919468249 1:197948236-197948258 GAGGCTGAGTTGAGGGTGGTAGG + Intergenic
919489930 1:198194437-198194459 GAGGGTGAAGGGTGGGAGGAGGG - Intronic
920776056 1:208938347-208938369 GAGGATGAGATGAAGGAGGAGGG - Intergenic
921120763 1:212134867-212134889 GAGGCCTACCTGAGGGTGGAGGG + Intergenic
921720504 1:218465395-218465417 GAGGCTGAGGTGAGGTGGGAGGG + Intergenic
922053773 1:222020814-222020836 GGAGTTGAACTGAGGGAGGATGG - Intergenic
922233365 1:223705013-223705035 GTGGATGAACTGGGGGAGTATGG - Intronic
922581713 1:226703348-226703370 GGGCCTGAGCTGAGGGCGGAGGG - Intronic
922705043 1:227786249-227786271 GCCCCTGAGCTGAGGGAGGAGGG - Intergenic
922859568 1:228804643-228804665 GAGGAAGAAAAGAGGGAGGAAGG - Intergenic
923482570 1:234397715-234397737 GAGGGGGAAGAGAGGGAGGAGGG + Intronic
923529818 1:234804285-234804307 GAGAGTGGACTGAGGGATGAGGG - Intergenic
923608189 1:235464468-235464490 GGGGAGGAAGTGAGGGAGGAAGG - Intronic
923698583 1:236279436-236279458 GAGGCTGCACTGAGCCAAGATGG + Intronic
924116719 1:240754279-240754301 GAGACTGAGCAGAGGGAAGAGGG - Intergenic
924212545 1:241785808-241785830 GAGGCTGAACTCTGGGATGCAGG + Intronic
924814211 1:247428098-247428120 GAGTCTGTCCTGAGGAAGGAAGG - Intronic
924852626 1:247845630-247845652 AAGGCTGCACTGAGGGAGGCTGG - Intergenic
1062929552 10:1343871-1343893 GAGGGTGAAGGGTGGGAGGAGGG + Intronic
1063561807 10:7135191-7135213 GAGGGTGGAGGGAGGGAGGAGGG - Intergenic
1063694608 10:8321336-8321358 GAAGCTTAACTGAGGGGTGATGG + Intergenic
1064031371 10:11885383-11885405 GAGGCGGAGCTGAGAGGGGATGG + Intergenic
1064031380 10:11885422-11885444 GAGGCCGAGCTGAGAGGGGATGG + Intergenic
1064031391 10:11885461-11885483 GAGGCCGAGCTGAGAGGGGATGG + Intergenic
1064031401 10:11885500-11885522 GAGGCCGAGCTGAGAGGGGATGG + Intergenic
1064031412 10:11885539-11885561 GAGGCCGAGCTGAGAGGGGATGG + Intergenic
1064031423 10:11885578-11885600 GAGGCCGAGCTGAGAGGGGATGG + Intergenic
1064219679 10:13429927-13429949 GAGGCTGCAGTGAGGTATGATGG + Intergenic
1065261369 10:23926792-23926814 GAGGAAGAAAAGAGGGAGGAAGG - Intronic
1065392107 10:25193352-25193374 GACTCTGAGCTGAGGAAGGAAGG + Intronic
1065643927 10:27814883-27814905 GAGGTTGAACTGATAGAGGATGG - Intronic
1066252402 10:33647208-33647230 GAGGGTGAAGGGTGGGAGGACGG + Intergenic
1066363267 10:34751666-34751688 GAGGCTGCAGTGAGGTATGATGG - Intronic
1066428058 10:35326822-35326844 GAGGCTGCACTGAGCTATGATGG + Intronic
1067332353 10:45333919-45333941 GAGGGTGAACTGAGGCAGGGTGG - Intergenic
1067781698 10:49212425-49212447 GAGGCAGGAGTGAGGGAGTAGGG - Intergenic
1067833219 10:49622023-49622045 GAGGCAGAAGGGAGGGAGGGAGG + Intronic
1068092851 10:52454359-52454381 GAGGCTATACTGAGGAAGGGAGG + Intergenic
1068573677 10:58659547-58659569 GCGGCCTAACTGAGGGTGGAGGG + Intronic
1068573683 10:58659558-58659580 GAGGGTGGAGGGAGGGAGGAGGG + Intronic
1068850354 10:61731749-61731771 GAGGGAGGACAGAGGGAGGAAGG + Intronic
1068858175 10:61818840-61818862 GAGGGTGAAGGGTGGGAGGAGGG + Intergenic
1069612191 10:69781589-69781611 GAGGCTGCAGGGAGGGAGGCAGG + Intergenic
1069666261 10:70162273-70162295 GAGGCTGCAGTGAGGCATGACGG + Intronic
1069958032 10:72063495-72063517 CCGGCGGAACTGTGGGAGGATGG - Intronic
1069964381 10:72101985-72102007 GAGGGTGGAGGGAGGGAGGAGGG + Intronic
1070152061 10:73811311-73811333 GAGGCGGTTCTGAGGGAGGCCGG + Intronic
1070399282 10:76038941-76038963 GAGGCTCAACTGGGGCTGGATGG + Intronic
1070610832 10:77931316-77931338 GAGGCTGTAGTGAGGTATGATGG - Intergenic
1070628969 10:78070875-78070897 GAGGCAGAAATTAAGGAGGAAGG - Intergenic
1070822372 10:79367387-79367409 GAGGCTGTACTGAGCCATGATGG + Intergenic
1071183986 10:83019501-83019523 GAGGCTTAACTCTAGGAGGAAGG + Intergenic
1071490865 10:86135469-86135491 GAGGCTCCCCTCAGGGAGGATGG - Intronic
1071580690 10:86766886-86766908 GAGGCTGCAGTGAGCCAGGATGG - Intronic
1072327061 10:94309393-94309415 GAGGCTGCAGTGAGCCAGGATGG - Intronic
1072375767 10:94814079-94814101 GAGGCTAAACTGAAGCAGGGAGG - Intronic
1072389643 10:94969730-94969752 GAGGCTAAACTGAAGCAGGGAGG - Intronic
1072790819 10:98316429-98316451 CAGGCTGAGCTGAGGGAAGCAGG + Intergenic
1073337856 10:102723970-102723992 GAGGGTGAAGGGTGGGAGGAGGG - Intronic
1073486183 10:103820510-103820532 GAGGGGGCACTGGGGGAGGAGGG - Intronic
1073614923 10:104984055-104984077 GTGGCTCCACTGAGGGTGGAAGG - Intronic
1073876343 10:107926451-107926473 GAGGGTGGACGGTGGGAGGAGGG + Intergenic
1073999314 10:109353251-109353273 GGGGCTTATTTGAGGGAGGAGGG - Intergenic
1074275708 10:111999944-111999966 GAAGCAGGAATGAGGGAGGAGGG + Intergenic
1074438278 10:113453008-113453030 GAGAGTCAGCTGAGGGAGGAAGG - Intergenic
1074739840 10:116475283-116475305 GAGGGTGAAGGGTGGGAGGAGGG + Intronic
1074978150 10:118597344-118597366 GAGGCTGAGAGGTGGGAGGATGG - Intergenic
1075087303 10:119422178-119422200 GAGGGTGAATGGTGGGAGGAGGG + Intronic
1075217371 10:120548220-120548242 GAGGGTGAAGGGTGGGAGGAGGG - Intronic
1075795544 10:125117055-125117077 GAGACTGCACTGAGGGTGGCTGG - Intronic
1076070051 10:127482115-127482137 GTGGCAGAACTGAGGGACAATGG - Intergenic
1076425516 10:130364679-130364701 GAGGCTGGAATGATGGAGGAAGG + Intergenic
1076583613 10:131531339-131531361 CATGCTGAGCTGAGGGAGGAGGG + Intergenic
1076677741 10:132156203-132156225 GAGACTGAGCCGAGGGAGGGAGG - Intronic
1076988130 11:253973-253995 GAGGCTGGACTTAGGGAGGGTGG - Intergenic
1077024579 11:433550-433572 GAGGCGGAATAGAGGGGGGAGGG - Intronic
1077274622 11:1698287-1698309 GAGGGTGGACGGTGGGAGGAGGG - Intergenic
1077280515 11:1742952-1742974 GAGGATGGACAGATGGAGGATGG + Intronic
1077280591 11:1743354-1743376 GAGGATGGACAGATGGAGGATGG + Intronic
1077316183 11:1920374-1920396 GGGGCTGGACTGGGGCAGGACGG + Intronic
1077463928 11:2724525-2724547 GTGGCTGCACTGAGGGCAGAAGG + Intronic
1077800181 11:5529080-5529102 GAGGGTGAAGGGTGGGAGGAGGG + Intronic
1078159012 11:8824342-8824364 GAGGGTGAAGGGTGGGAGGAGGG - Intronic
1078182286 11:9022168-9022190 GAGGCTCGTCTGAGGGAAGAGGG - Intronic
1078663266 11:13304179-13304201 GAGAGTGGACTGAGGGAGCAAGG + Intronic
1079097718 11:17521621-17521643 GATGCTGGGCTGTGGGAGGAGGG + Intronic
1079306262 11:19326130-19326152 GAGGCCTACCTGAGGGTGGAGGG + Intergenic
1079789465 11:24717742-24717764 GAGGGTGAAGGGAGGGAGGAGGG - Intronic
1080032862 11:27680277-27680299 GAGAATGAAAAGAGGGAGGAAGG + Intronic
1080604678 11:33855164-33855186 GAGGAAGAACGGAAGGAGGAAGG + Intergenic
1080643335 11:34170968-34170990 CATGCTCAACTGTGGGAGGACGG - Exonic
1080752642 11:35165126-35165148 GGGGCTGGAGTGAGGGTGGAAGG - Intronic
1081358881 11:42147246-42147268 GAAGCTGAAGGGTGGGAGGAGGG - Intergenic
1081695672 11:45107520-45107542 GAAGCAGAACAGAGGGTGGATGG + Intronic
1081753871 11:45531103-45531125 CAGGCTGGAGTGAGAGAGGAGGG + Intergenic
1082716211 11:56617403-56617425 GAGGGTGAAGTGTGGGAGGAGGG - Intergenic
1083252967 11:61480296-61480318 GAGGCTGGACTGAGCTATGATGG + Intronic
1083362372 11:62119576-62119598 GAGACTGGAGTGTGGGAGGAGGG - Intergenic
1083808652 11:65089861-65089883 GAGGCTGTGCTGAGTGAGCAGGG + Intronic
1083851340 11:65369242-65369264 GTGGCTGAACTGAGAGCTGAAGG + Intergenic
1084526257 11:69699982-69700004 GAGGCTGAGAGGTGGGAGGATGG + Intronic
1084568192 11:69943543-69943565 GAAGCTGACCTGAGCGAGGTGGG + Intergenic
1084627968 11:70323426-70323448 GAGGCTGGACAGAGGTAGGAAGG + Intronic
1084697260 11:70763060-70763082 GAGCCTGATCTGAAGGAGCAGGG + Intronic
1084788855 11:71460413-71460435 GAGGCTGCAGTGAGCCAGGATGG - Intronic
1085159057 11:74324298-74324320 GAGTATGAATTCAGGGAGGATGG - Intergenic
1085403474 11:76248104-76248126 AGGGCTGAGCTAAGGGAGGAGGG - Intergenic
1085495029 11:76961068-76961090 GAGCCTGAATTGAGTGAGAAGGG + Intronic
1085543046 11:77289848-77289870 GAGGGAGAAGGGAGGGAGGAGGG + Intronic
1086020530 11:82224152-82224174 GAGGGTGAAGAGTGGGAGGAGGG - Intergenic
1086068535 11:82772635-82772657 GAGGGTGAACGGTGGGAGGAGGG - Intergenic
1086102330 11:83114111-83114133 GAGGCTGAAGCGAGGGCAGATGG - Intergenic
1086563216 11:88192891-88192913 GAGGCTTACCTGAGGGTGGAGGG - Intergenic
1086731832 11:90259565-90259587 GAGGATGAAGGGAGGAAGGAGGG + Intergenic
1087376662 11:97351238-97351260 GAGGCTGGAAGGTGGGAGGAGGG + Intergenic
1087741144 11:101888355-101888377 GAGGGTGAAAGGTGGGAGGAGGG + Intergenic
1087945001 11:104148735-104148757 GAGGATGAAGGGTGGGAGGAGGG - Intronic
1088270765 11:108032019-108032041 GAGGGTGAAGGGTGGGAGGAGGG + Intronic
1088905441 11:114151878-114151900 GAAGCTGAAGGTAGGGAGGATGG + Intronic
1089318813 11:117611118-117611140 GAGGCTGACATGAGGTAGGCTGG - Intronic
1089330058 11:117682804-117682826 GAGGCTGGCTGGAGGGAGGAAGG + Intronic
1089482253 11:118815591-118815613 GAGGCTGCAGTGAGGCAAGATGG - Intergenic
1090283192 11:125475583-125475605 GAGGATGAAGGGTGGGAGGAGGG + Intronic
1090387021 11:126363293-126363315 GAGGCAGAAAGGAAGGAGGAGGG - Intronic
1090727847 11:129543858-129543880 GAGCCTACACTGAGGGAGGGAGG + Intergenic
1090805985 11:130202520-130202542 GTGTCTGAACTGAGGGTTGAAGG + Intronic
1091319124 11:134637337-134637359 GAGGCTGTGGTGGGGGAGGAGGG + Intergenic
1091490251 12:926437-926459 AAGGCTGCACTGAGCGATGACGG + Intronic
1091672433 12:2462051-2462073 GGGGGTGAGCTTAGGGAGGAAGG - Intronic
1092094585 12:5831142-5831164 GAGGATGCACTGATGAAGGAAGG + Intronic
1092351162 12:7756827-7756849 GAGGCTGTAGTGAGGTATGATGG + Intergenic
1092724391 12:11470798-11470820 GAGGGTGGACGGTGGGAGGAGGG + Intronic
1093074631 12:14745204-14745226 GAGGCTGAACTGAAAGGGGTAGG + Intergenic
1093167175 12:15817503-15817525 GAGGGTGGAGGGAGGGAGGAGGG + Intronic
1093422332 12:18988669-18988691 GAGGCTGAGGTGAGGCAGGAGGG - Intergenic
1093554509 12:20454617-20454639 GAGGCTGGAGGGTGGGAGGAAGG - Intronic
1094048544 12:26194923-26194945 GAGGCTGCAGTGAGCTAGGATGG + Intronic
1094205197 12:27832276-27832298 GAGGGTGAAGAGCGGGAGGAGGG - Intergenic
1094531907 12:31283737-31283759 GAGGATGAGATGAGGTAGGATGG - Intronic
1095444923 12:42273781-42273803 GGGGCTGCACTGAAGGGGGAAGG + Intronic
1095488407 12:42708037-42708059 GAGGGTGAGCTGAGGCAGGGTGG + Intergenic
1095846366 12:46749677-46749699 GAGGGTGAAGGGTGGGAGGAGGG + Intergenic
1095866679 12:46979740-46979762 GAGGAGGAAGGGAGGGAGGAAGG + Intergenic
1096014902 12:48261898-48261920 GAGGGTGAAGGGTGGGAGGAGGG - Intergenic
1096014909 12:48261916-48261938 GAGGGTGAAGGGTGGGAGGAGGG - Intergenic
1096014916 12:48261934-48261956 GAGGGTGAAGGGTGGGAGGAGGG - Intergenic
1096478868 12:51924775-51924797 AAGGCAGGACTGAGGGAGGATGG - Intergenic
1096536062 12:52275583-52275605 AAGCCTGAACTCAGGCAGGAAGG - Intronic
1096791721 12:54049091-54049113 GAGGCTGGGATGAGGGAGGAAGG + Intronic
1096836564 12:54354977-54354999 GAGGTGGGACTGAGGTAGGAGGG + Intergenic
1096909099 12:54963947-54963969 GATGCTGAAATGAGGGAGTTTGG + Exonic
1097281906 12:57850188-57850210 GAGGGGTAAATGAGGGAGGAGGG + Intergenic
1097640228 12:62172238-62172260 GAGGATGAAGGAAGGGAGGAAGG - Intronic
1098113981 12:67155281-67155303 GAGGCTGCAGTGAGCTAGGATGG - Intergenic
1098895977 12:76061272-76061294 GAGGGTGGAGTGTGGGAGGAGGG - Intronic
1099512687 12:83556526-83556548 GAGGGTGAGCTGAAGGAGGGTGG - Intergenic
1099813300 12:87613619-87613641 GAGGGTAAAATGTGGGAGGAGGG - Intergenic
1099941327 12:89192746-89192768 GTGGCTCAGCAGAGGGAGGAAGG + Intergenic
1100166189 12:91920774-91920796 GAGGGTGAAATTGGGGAGGAGGG - Intergenic
1100353694 12:93808977-93808999 GAGGCTGAAGTGAGCCAAGAAGG - Intronic
1100393674 12:94165879-94165901 GAGGAGGAAGTGAGGGAAGAGGG + Intronic
1100620693 12:96269993-96270015 GAGGCTGACTTGTGGGAGAATGG + Intergenic
1101000533 12:100353276-100353298 GAGGCTGGAGGGTGGGAGGAGGG - Intergenic
1101259573 12:103014419-103014441 GAGGGAGAAGGGAGGGAGGAAGG - Intergenic
1101676579 12:106922418-106922440 GGGGCTGGAGTGAGGGAGGTGGG - Intergenic
1101703752 12:107200412-107200434 GAGGCTGAAGTGCAGGAGGATGG - Intergenic
1102188134 12:110965549-110965571 GAGGCAGAAGGGAGGGAGGGAGG - Intergenic
1102419844 12:112794842-112794864 CAGGCTGGACTGGGGGAGTAGGG - Intronic
1102771438 12:115480650-115480672 GAGACTGGAGTGTGGGAGGAGGG - Intergenic
1103006596 12:117425661-117425683 GAGGGTGAAGGGTGGGAGGAGGG + Intronic
1103439975 12:120955857-120955879 GAGGCTGCAGTGAGCTAGGATGG - Intergenic
1103459000 12:121089101-121089123 CAGGCTGAACAGTGTGAGGAGGG + Intergenic
1103520695 12:121535821-121535843 GGGGCAGAGCTGAAGGAGGAGGG + Intronic
1103917815 12:124385025-124385047 GAGGGAGAAAGGAGGGAGGAAGG + Intronic
1104017985 12:124973075-124973097 GAGGCTGCACTGAGCAAAGATGG + Intronic
1104133665 12:125917737-125917759 GAAGATGTCCTGAGGGAGGAGGG + Intergenic
1104517945 12:129445308-129445330 GAGGGTGGAGTGTGGGAGGAAGG + Intronic
1104605537 12:130184934-130184956 GAGGCTGGACTGAGGGCTGAGGG - Intergenic
1104896546 12:132167702-132167724 GAGGCTGCAGAGAGGGAGGGTGG - Intergenic
1104946679 12:132417748-132417770 GAGGCTGGGCCGTGGGAGGAGGG - Intergenic
1105034196 12:132906824-132906846 GAGGCTGAAGTGAGCTATGATGG + Intronic
1105056503 12:133104940-133104962 GAGGGTGGAATGTGGGAGGAGGG - Intronic
1105584797 13:21733968-21733990 GAAGCTTAACTGAGGGAAGCTGG - Intergenic
1105679843 13:22714709-22714731 GAGGCTGAAGTGAGCTACGAAGG + Intergenic
1105776026 13:23661184-23661206 GAGGGTGGAGTGTGGGAGGAGGG - Intronic
1105855865 13:24371346-24371368 GAGGGTGAGCTGATGAAGGAGGG + Intergenic
1106178071 13:27348219-27348241 GAGGCTGAGGTGAGGTGGGAGGG - Intergenic
1107115676 13:36742961-36742983 GAGGCCGACCTGGGGGAGGAAGG + Intergenic
1107223597 13:38018669-38018691 GAGGGTGAAGGGTGGGAGGAAGG - Intergenic
1107584911 13:41835081-41835103 GAGGGTGAGAGGAGGGAGGAGGG + Intronic
1107634328 13:42377095-42377117 GAGGCTGCAGTGAGCAAGGATGG - Intergenic
1107703938 13:43080229-43080251 GAGGCCTACCTGAGGGTGGAGGG - Intronic
1107885040 13:44868014-44868036 GAGTCAGCCCTGAGGGAGGAGGG - Intergenic
1108967077 13:56321868-56321890 GAGGGTGAAGGGTGGGAGGAGGG - Intergenic
1108970188 13:56364669-56364691 GAGGCTGTAGTGTGGGAGGAGGG + Intergenic
1109295284 13:60523639-60523661 GAGGCTGCAGTGAGGGAAGATGG - Intronic
1109301871 13:60597948-60597970 GGGGCGGACCTGAGGGTGGAGGG - Intergenic
1109317562 13:60768353-60768375 GAGGGTGAAGGGTGGGAGGAGGG - Intergenic
1109374818 13:61478603-61478625 GAGGGTAAAGGGAGGGAGGAAGG - Intergenic
1109890902 13:68613252-68613274 GAGGGTGGAGTGTGGGAGGAGGG - Intergenic
1110523324 13:76506240-76506262 GAGGGTGGAGGGAGGGAGGAGGG + Intergenic
1110781647 13:79472864-79472886 GAGGCTGGACTAAGCGAGGTAGG + Intergenic
1111077397 13:83255245-83255267 GAGGGTGAAGGGTGGGAGGAGGG + Intergenic
1111084272 13:83353002-83353024 GAGGGTGAAGGGTGGGAGGAGGG + Intergenic
1111435143 13:88196829-88196851 GAGGTTGAAGAGTGGGAGGAGGG - Intergenic
1111856437 13:93643482-93643504 TAGGCTGAACAGAGGTAGGCAGG + Intronic
1112065577 13:95789299-95789321 GAGGGTGAAGGGTGGGAGGAGGG - Intronic
1112539675 13:100296303-100296325 GAGGCTGCAGTGAGGCAAGATGG - Intronic
1112721217 13:102248087-102248109 GAGGGTGGAGTGTGGGAGGAGGG + Intronic
1113062188 13:106334376-106334398 GAGGCTGCAGTGAGCGATGATGG - Intergenic
1113397109 13:109958133-109958155 GAGGGTGGAGAGAGGGAGGAAGG - Intergenic
1113439565 13:110317525-110317547 GAGGCTGGACAGAGGCGGGAGGG + Intronic
1113739345 13:112700617-112700639 GGGGCTGAACTGGGCCAGGAGGG - Intronic
1113784045 13:112993164-112993186 GAGGCTGTACTGACAGAGGCTGG + Intronic
1113887494 13:113668487-113668509 CAGGAGGAACTGAGGCAGGACGG + Intronic
1114269972 14:21094550-21094572 GAGGCTGGAGTGAGGGACGGGGG + Intronic
1114290671 14:21285868-21285890 CAGGCAGAAATAAGGGAGGATGG + Intergenic
1114317119 14:21519702-21519724 GAGGCTGAAGTGGGAGATGAAGG - Intergenic
1114382684 14:22224649-22224671 GAGGATGAAGGGTGGGAGGAAGG - Intergenic
1114471651 14:22967355-22967377 GAGGCTGTACTGAGCCATGATGG - Intronic
1114484520 14:23054951-23054973 GAGGCTGAATTGAAGGGGGCAGG + Intronic
1114484945 14:23056877-23056899 GTGTCTGCTCTGAGGGAGGAGGG - Intronic
1114871953 14:26669284-26669306 GATGCAGAACTCAGGGAAGAAGG + Intergenic
1114950476 14:27744940-27744962 GAGGGTGAAGGGTGGGAGGAGGG + Intergenic
1115156357 14:30344002-30344024 GAGGCTGAGAGGTGGGAGGATGG - Intergenic
1115214108 14:30997559-30997581 GAGGCTGAAGACAGGAAGGAGGG - Intronic
1115294039 14:31805752-31805774 GAGGGTGAAGGGTGGGAGGAAGG + Intronic
1115522924 14:34251284-34251306 GAGGCTTAAATGAGTAAGGAAGG - Intronic
1115648031 14:35383886-35383908 AAGGGTAAACTGAGGGAGGGAGG + Intergenic
1115858605 14:37658916-37658938 GAGGGTGAAGGGTGGGAGGAGGG - Intronic
1115915416 14:38307130-38307152 CAGGGTGAAGGGAGGGAGGAGGG + Intergenic
1116141847 14:41006037-41006059 GAGGGTGAAGGGTGGGAGGAGGG - Intergenic
1116252937 14:42509987-42510009 GAGGGTGGAAGGAGGGAGGAGGG + Intergenic
1116348393 14:43827192-43827214 GAGGGTGAAGGGTGGGAGGAAGG - Intergenic
1116537153 14:46046974-46046996 GAGGGTGAAATGAAGAAGGAGGG - Intergenic
1116554169 14:46281923-46281945 GAGGCTTATTTGAGGGAGCATGG + Intergenic
1116558690 14:46347590-46347612 GAGGGTGGAGAGAGGGAGGAGGG + Intergenic
1116819723 14:49616219-49616241 GAGGCTGACTTGAGGTAGGTCGG - Intergenic
1117079101 14:52133083-52133105 GAGGCTGAGCTGAGGGAGGAGGG + Intergenic
1117506567 14:56409605-56409627 GAGGATGAAGGGTGGGAGGAGGG + Intergenic
1117736573 14:58774309-58774331 AAGGAGGAAATGAGGGAGGAAGG - Intergenic
1117738442 14:58791079-58791101 GGGGCCTAACTGAGGGTGGAGGG - Intergenic
1117785107 14:59275284-59275306 GAGGGTGAAGGGTGGGAGGAGGG + Intronic
1118004977 14:61557559-61557581 GAGAGTGAACTGAGTGATGAAGG + Intronic
1118073398 14:62271120-62271142 GAGGATGGAGAGAGGGAGGATGG - Intergenic
1118426459 14:65669028-65669050 GAGGGTGAAAGGTGGGAGGAGGG + Intronic
1118598880 14:67457539-67457561 GAGGCTGCAGTGAGCTAGGATGG + Intronic
1119714261 14:76847537-76847559 GAGGGTGGAGGGAGGGAGGAGGG + Intronic
1120467174 14:84874147-84874169 GAGGGTGAGGTGTGGGAGGAAGG - Intergenic
1120566476 14:86064951-86064973 GAGGGTGAAGGGTGGGAGGAGGG + Intergenic
1120782052 14:88494184-88494206 CAGGCTGCAATGAGGGAGCAAGG + Intronic
1121012941 14:90532756-90532778 GTGGCTGAACACAGGCAGGAAGG + Exonic
1121122198 14:91383104-91383126 GAGGCTGCAGTGATGCAGGAAGG - Intronic
1121345764 14:93134823-93134845 GAGGCTGAAGTGAGCTATGATGG - Intergenic
1121504760 14:94468366-94468388 GTGGATGAAGGGAGGGAGGAAGG + Intronic
1121573087 14:94962129-94962151 GAGGCTGAGCTGGGTGGGGAGGG + Intergenic
1121726829 14:96158465-96158487 GAGGATGAACAGAGGTAGAAGGG + Intergenic
1121800197 14:96768652-96768674 GAGGAAGAAGGGAGGGAGGAAGG - Intergenic
1121835545 14:97088867-97088889 GAGGATGACCTGGAGGAGGAAGG + Intergenic
1121837816 14:97107679-97107701 GAGGGTGGAGTGAGGGAGGAGGG + Intergenic
1122207776 14:100156757-100156779 GGGACTGAACTGAGCGAGCAAGG + Intronic
1122280763 14:100620969-100620991 GAGGCTGGCTGGAGGGAGGATGG - Intergenic
1122459132 14:101880730-101880752 GAGGCTGCAGTGAGCGATGATGG + Intronic
1122462672 14:101908436-101908458 GAGGCTGCAGTGAGCCAGGATGG - Intronic
1122650340 14:103222541-103222563 GAGGCTGAGGTGGGGCAGGAGGG + Intergenic
1122907149 14:104806929-104806951 GAAGCTCCACTGAGTGAGGAGGG - Intergenic
1123503454 15:20913581-20913603 GAGGAAGCAGTGAGGGAGGAAGG + Intergenic
1123560701 15:21487246-21487268 GAGGAAGCAGTGAGGGAGGAAGG + Intergenic
1123596940 15:21924542-21924564 GAGGAAGCAGTGAGGGAGGAAGG + Intergenic
1123996370 15:25720632-25720654 GAGGCTGGTGGGAGGGAGGATGG + Intronic
1124228827 15:27922955-27922977 GAGGATGAAAGGTGGGAGGAGGG - Intronic
1124609678 15:31200038-31200060 GAGGCAGAGCTCAGGGAAGAGGG + Intergenic
1125173225 15:36790991-36791013 GAGGGTGGACAGTGGGAGGAGGG - Intronic
1125194611 15:37031901-37031923 GAGGCTGCAGTGAGCTAGGATGG - Intronic
1125955665 15:43789345-43789367 TGGGATGACCTGAGGGAGGAGGG + Intronic
1126105660 15:45145357-45145379 CAGGCTGAGATGAGTGAGGATGG - Intronic
1126670860 15:51113864-51113886 GTGGCTGATCTGAGGGAGGCTGG - Intergenic
1126946102 15:53822226-53822248 GAGTCCCAACTGAAGGAGGAAGG + Intergenic
1127457212 15:59165934-59165956 CTGGCTGAACTGTGGCAGGATGG + Intronic
1127618171 15:60707844-60707866 GAGGCTAAACTTAGAGAGTAGGG - Intronic
1127679259 15:61276783-61276805 GGAAGTGAACTGAGGGAGGAGGG - Intergenic
1128726630 15:69992705-69992727 CAGGCTGGAGTGAGTGAGGAGGG - Intergenic
1128883590 15:71265299-71265321 GAGGCTGAGCTGAAGCAGGGTGG + Intronic
1128898574 15:71398356-71398378 GAGGGTGACCTGAAGAAGGAAGG + Intronic
1129028095 15:72598044-72598066 GAGGATCAACTGAGCCAGGAAGG - Exonic
1129163882 15:73764194-73764216 GAGGCTGAACTCAGGAGGAAGGG + Intergenic
1129220771 15:74130478-74130500 GCGGCTGAAGTGGGGGGGGAAGG - Intronic
1129868491 15:78926231-78926253 GAGGCAGGACTGAGGGAGGCTGG - Intronic
1130059194 15:80557453-80557475 GAGGGTGGACAGTGGGAGGAGGG + Intronic
1130565622 15:84992405-84992427 GAGGCTGACCAGAGATAGGACGG + Intronic
1130743521 15:86626501-86626523 GAGGCTGCAAGGTGGGAGGAGGG + Intronic
1131097985 15:89667785-89667807 CAGGCTGCTCTGAGGGAGGATGG + Exonic
1131194695 15:90346274-90346296 GAGGCTGCAGTGAGCCAGGATGG - Intergenic
1131225048 15:90617592-90617614 GAGGCTGCACTGAGTCATGACGG - Intronic
1131293726 15:91129408-91129430 GAGATGGAACTGGGGGAGGAAGG + Intronic
1131297681 15:91165654-91165676 GAGACAGACCTGAGGGAGGAAGG + Intronic
1131424193 15:92332114-92332136 CAGCCTGAAGGGAGGGAGGAGGG - Intergenic
1131585824 15:93691699-93691721 GAGGATTAACTGAGGGAGGAGGG + Intergenic
1131951023 15:97682130-97682152 AAGGCTGAAATGAGAGAAGATGG + Intergenic
1132226997 15:100150571-100150593 GAGGAGGGACAGAGGGAGGAAGG - Intronic
1202969048 15_KI270727v1_random:214410-214432 GAGGAAGCAGTGAGGGAGGAAGG + Intergenic
1132479093 16:157427-157449 GAGGCTGAGTTGGGGGTGGAGGG + Intronic
1132702055 16:1226185-1226207 GCGGCTGCCGTGAGGGAGGAGGG - Intergenic
1132706259 16:1244682-1244704 GCGGCTGCCGTGAGGGAGGAGGG + Intergenic
1132789133 16:1675371-1675393 GGGGATGAAATGAGGCAGGAAGG - Exonic
1132804869 16:1770824-1770846 CAGGCTGAACAGGGGGAGGCCGG + Intronic
1132887324 16:2188249-2188271 GAGGCTGCAGTGAGCCAGGATGG - Intronic
1133165971 16:3947466-3947488 GAGGCTGAAGTGAGCCATGAGGG - Intergenic
1133564558 16:6981260-6981282 GAGGGTGAATGGTGGGAGGAGGG - Intronic
1133994746 16:10739933-10739955 GGGCCTGAGCTGAGGCAGGAGGG + Intergenic
1134064522 16:11219220-11219242 GAGGCTGAAGAGTGAGAGGAAGG - Intergenic
1134504000 16:14790794-14790816 GAGGCTGAGGTCAGGGAGGGAGG + Intronic
1134561117 16:15210713-15210735 GAGGCTGAGAGGTGGGAGGACGG - Intergenic
1134576572 16:15338114-15338136 GAGGCTGAGGTCAGGGAGGGAGG - Intergenic
1134725867 16:16418385-16418407 GAGGCTGAGGTCAGGGAGGGAGG + Intergenic
1134793235 16:17010134-17010156 GAGGCTGCAATGAGCTAGGATGG + Intergenic
1134921654 16:18122333-18122355 GAGGCTGAGAGGTGGGAGGACGG - Intergenic
1134941566 16:18293474-18293496 GAGGCTGAGGTCAGGGAGGGAGG - Intergenic
1135862096 16:26065472-26065494 GAGGCTGGAGGGTGGGAGGAGGG + Intronic
1136113028 16:28076811-28076833 GAGGCTGAAGTGAGCTATGATGG + Intergenic
1136268022 16:29132159-29132181 GAGGATGGAGGGAGGGAGGAAGG + Intergenic
1136343849 16:29663067-29663089 GGGGCTCACCTGAGGGAGGCAGG - Intronic
1137721452 16:50629995-50630017 GAAGCAGAAATGAGGGAGCAGGG - Intronic
1137859373 16:51830803-51830825 GAGGCTGAGTCGAGGTAGGAGGG - Intergenic
1137928531 16:52564641-52564663 GAGGCTGAGGTGGGGGAGCATGG - Intergenic
1138131737 16:54485612-54485634 AAGGCTGCAATGAGGGATGATGG + Intergenic
1138524097 16:57591934-57591956 GAGGCTGGACGGATGGATGACGG - Intergenic
1138613716 16:58147764-58147786 CAGGCAGCACTGAGGGAGGAGGG - Intergenic
1138754561 16:59467964-59467986 GAGGGTGAAGTGTGGGAGGAGGG - Intergenic
1138880029 16:61001858-61001880 GAGGCTGTAGTGAGTGAAGATGG + Intergenic
1139248042 16:65466916-65466938 GAGGATGAAATGAGGGTGGGTGG + Intergenic
1139253531 16:65519566-65519588 GAGGTAGAAAGGAGGGAGGAAGG - Intergenic
1139707388 16:68750767-68750789 GAGGCTGAAGTGAGCCAAGATGG - Intronic
1140028246 16:71311576-71311598 GCGGCTGAGCAGAGGGAGCAAGG + Intergenic
1140214852 16:72999212-72999234 GAGGTTGCAGTGAGGGAAGATGG - Intronic
1140350531 16:74257976-74257998 GAGGCTGAGAGGTGGGAGGACGG + Intergenic
1141127098 16:81408576-81408598 GAGGCTGAAGTGGGGGTTGATGG - Intergenic
1141127662 16:81412579-81412601 GAGGCTGCACTGAGCCAAGATGG - Intergenic
1141139672 16:81489229-81489251 GAGGCTGACTTGAGGGGTGAGGG + Intronic
1141451813 16:84108692-84108714 GAGTCTGAGCGGAGTGAGGAAGG + Intronic
1141511442 16:84514638-84514660 AAGCCTGATCTGGGGGAGGATGG + Intronic
1141830947 16:86509852-86509874 GGGGCTGAACCGCGGGCGGAGGG + Intergenic
1141881713 16:86864575-86864597 GAGGGTGGAGGGAGGGAGGAGGG - Intergenic
1142016260 16:87749646-87749668 GAGGCTGCAGTGAGTGATGATGG - Intronic
1142251420 16:88993706-88993728 GAGGAGGAAGGGAGGGAGGAGGG - Intergenic
1142252609 16:88999633-88999655 GGGGCGGGACAGAGGGAGGAGGG + Intergenic
1142742693 17:1940424-1940446 GAGGGGAAACTGAGGTAGGAGGG - Intronic
1142836148 17:2588731-2588753 GATGCTGAGATGAGGAAGGACGG + Intergenic
1143161524 17:4874854-4874876 TGGGCGGCACTGAGGGAGGAAGG - Intronic
1143415511 17:6745902-6745924 GAGGCTGAAAGTTGGGAGGAGGG + Intergenic
1143602393 17:7956743-7956765 GAGGCTGGAGGGTGGGAGGAGGG - Intergenic
1144375794 17:14639814-14639836 GAGGCTGGATGAAGGGAGGAAGG + Intergenic
1144654289 17:17025407-17025429 GAGGTAGACCTGAGGGAGGGAGG + Intergenic
1144655325 17:17031511-17031533 GAGGCTGCAGTGAGCTAGGATGG - Intergenic
1144773533 17:17772404-17772426 GTGGCTGCAGTGAGGCAGGATGG - Intronic
1145262283 17:21361511-21361533 GTGGCTGAACAGAGGGAGCGGGG - Intergenic
1146053851 17:29571685-29571707 GAGGCTGAAGTCAGGGGTGAGGG - Exonic
1146109544 17:30075714-30075736 GAGCCTGAGCAGAGCGAGGAGGG - Intronic
1146488437 17:33262424-33262446 GAGGAGGAAGGGAGGGAGGAAGG + Intronic
1146507682 17:33419354-33419376 GAGGCTCATTTGAGGGATGAAGG + Intronic
1146532177 17:33617498-33617520 GAGGGTGGAGGGAGGGAGGAGGG + Intronic
1147007312 17:37413942-37413964 GAGGGTGAACAGTGGGAGGAGGG - Intronic
1147157624 17:38552192-38552214 AAGGCTGCTCTGAGGGAGGTGGG + Intronic
1147170677 17:38617029-38617051 ACAACTGAACTGAGGGAGGAAGG + Intergenic
1147498753 17:40942321-40942343 GAGGGGGAAGAGAGGGAGGAGGG - Intergenic
1147807117 17:43139682-43139704 GAGGGTGAAGGGTGGGAGGAGGG - Intergenic
1147861421 17:43526114-43526136 GAGCCTGCTCTGAGGGAGAAGGG + Intronic
1148141015 17:45328678-45328700 GAGGCTGCAGTGAGGCATGATGG - Intergenic
1148851369 17:50557049-50557071 GAGGTGGAAGAGAGGGAGGATGG + Intergenic
1150175330 17:63048798-63048820 GAGGGTGAAGGGTGGGAGGAGGG + Intronic
1150280287 17:63926086-63926108 GACCCTGAACCGAAGGAGGAGGG - Intergenic
1150525945 17:65922911-65922933 GAGGCTGGAATTGGGGAGGAAGG - Intronic
1150652533 17:67019343-67019365 GAGGAGGAGGTGAGGGAGGAAGG - Intronic
1151301443 17:73230229-73230251 GAGGCTGCAGTGAGGCATGATGG + Intronic
1151345804 17:73500531-73500553 GAAGGAGAACTGAGGGGGGATGG - Intronic
1151345870 17:73500812-73500834 GATGGAGAACTGAGGGAGGATGG - Intronic
1151401366 17:73857996-73858018 GAGGGGGCCCTGAGGGAGGAGGG - Intergenic
1151425356 17:74027706-74027728 AGGGCTGAGATGAGGGAGGAAGG + Intergenic
1151981835 17:77516347-77516369 GAGGATGAAGGGTGGGAGGAGGG - Intergenic
1152081478 17:78190228-78190250 GAGGCTGGGCTGGAGGAGGAGGG - Intronic
1152492875 17:80649530-80649552 AAGGCAGAACTGTGGGTGGATGG + Intronic
1152813013 17:82391096-82391118 GAGGAGGTGCTGAGGGAGGAGGG + Intronic
1153078421 18:1192598-1192620 GAGGGTGAAGGGTGGGAGGAGGG + Intergenic
1153329152 18:3855280-3855302 GAGGGTGGAGGGAGGGAGGAAGG + Intronic
1153359511 18:4177608-4177630 GAGGGTGGATGGAGGGAGGAAGG - Intronic
1153505483 18:5792665-5792687 GAGGATGAAGAGTGGGAGGAGGG + Intergenic
1153574120 18:6503974-6503996 GAGGAGGAAGGGAGGGAGGAGGG + Intergenic
1153836750 18:8970484-8970506 GAGGGGGAAGGGAGGGAGGAAGG + Intergenic
1153911827 18:9711435-9711457 GAGGCTGCAGTGAGCCAGGATGG - Intronic
1155100077 18:22602141-22602163 GGGGCTGACTTGAGGGTGGAGGG - Intergenic
1155494944 18:26433576-26433598 GAGGGTGAAGGGTGGGAGGAGGG - Intergenic
1155513892 18:26604737-26604759 GAGGGTGAAGGGTGGGAGGAGGG + Intronic
1155741556 18:29295324-29295346 GAGGGTGAAAGGTGGGAGGAGGG + Intergenic
1156087203 18:33420281-33420303 GAGGGTGGGGTGAGGGAGGAAGG + Intronic
1156278088 18:35604069-35604091 GAGGGTGAAGGGTGGGAGGAGGG - Intronic
1156594775 18:38535847-38535869 GAGACTGAAAGAAGGGAGGAAGG - Intergenic
1157052531 18:44183989-44184011 GAGGTTGGAGGGAGGGAGGAGGG + Intergenic
1157256595 18:46145071-46145093 GAGGCTGCACTGAGTGGTGATGG + Intergenic
1157340186 18:46771409-46771431 AAGGCTGATGAGAGGGAGGATGG - Intergenic
1157616105 18:48988708-48988730 CAGCCTGAGCTGGGGGAGGAGGG + Intergenic
1157850301 18:51042384-51042406 GAGCCTGAAGTAAGGGAGGGAGG - Intronic
1157988894 18:52471973-52471995 GAGGCTGAGAGAAGGGAGGAAGG + Intronic
1158027315 18:52915733-52915755 GAGGCAGAAAAGAGGAAGGAAGG + Intronic
1158095870 18:53770084-53770106 GAGGCTGGAGGGTGGGAGGAGGG + Intergenic
1158388126 18:57018151-57018173 GATGCTAATCTGAAGGAGGAAGG + Intronic
1158467304 18:57702216-57702238 GAGGCTGTCTTGATGGAGGAAGG - Intronic
1158813957 18:61071959-61071981 GAGGATGAAGTGTGGGAAGAGGG + Intergenic
1159032244 18:63243362-63243384 GAGGATGAAGGGTGGGAGGAGGG + Intronic
1159531683 18:69663293-69663315 GAGGATGAAGGGTGGGAGGACGG + Intronic
1159608274 18:70497986-70498008 GATGCAGATATGAGGGAGGAGGG - Intergenic
1160229333 18:77034571-77034593 GAGGCTCCACTGTGGGAGGCAGG - Intronic
1160356147 18:78229695-78229717 GAGGAGGAAGGGAGGGAGGAAGG - Intergenic
1160483507 18:79265054-79265076 GAGGCTGGAGGGTGGGAGGAGGG - Intronic
1160538632 18:79608714-79608736 CAGGCTGAGCTGCGGGAGGATGG + Intergenic
1161220307 19:3115338-3115360 GAGGCTGAAGTGAGCCATGATGG + Intronic
1161369162 19:3900254-3900276 GAGGCTGCAGTGAGGTATGATGG - Intronic
1161377935 19:3949753-3949775 GAGGCTGCAGTGAGCGATGAGGG - Intergenic
1161404461 19:4083892-4083914 GAGGCTGAAGTGAGCTATGATGG + Intergenic
1161467951 19:4442606-4442628 AAGGCTGCACTGAGGCAGCAAGG + Intronic
1161620877 19:5296434-5296456 GAGGCTGCAGTGAGCTAGGATGG + Intronic
1161734395 19:5982085-5982107 CAGGCTGCAGTGAGGTAGGATGG + Intergenic
1161776134 19:6263260-6263282 GAGGCAGAACAGAGGAAGGGTGG + Intronic
1162337868 19:10072836-10072858 GGGGCTGAAGGGAGGGAGGGTGG + Intergenic
1162476499 19:10903623-10903645 GAGGCTGTAGTGAGGTATGATGG - Intronic
1162539586 19:11286502-11286524 GAGGCTGGACTGAGCTATGATGG + Intergenic
1162539807 19:11288026-11288048 GAGGCTGCAGTGAGGTATGATGG - Intergenic
1162574970 19:11493952-11493974 GAGGCTGAAGTGAGCTATGATGG + Intronic
1162717043 19:12640726-12640748 GAGGGTGGAAGGAGGGAGGAAGG + Intergenic
1162804072 19:13127780-13127802 GAGGCTGAAGTGAGCTATGATGG + Intronic
1163213111 19:15856475-15856497 GAAGCTGAAATGATGGAGGCGGG - Intergenic
1163786338 19:19276855-19276877 CTGGCTGGACTGAGGAAGGAAGG + Intronic
1164526134 19:29014936-29014958 GAGGCTGCCCTGAGCAAGGAGGG - Intergenic
1164730967 19:30504302-30504324 GAGGCTGGTGGGAGGGAGGAAGG - Intronic
1164744176 19:30599198-30599220 GAGGAAGAAGGGAGGGAGGAAGG - Intronic
1164917645 19:32064954-32064976 GAAGGTGAAGTGTGGGAGGAGGG - Intergenic
1165195030 19:34095493-34095515 GAGGCTGTAGTGAGCTAGGATGG - Intergenic
1165308656 19:35017696-35017718 AAGGAGGAACTGAGGAAGGAAGG - Intronic
1165706600 19:37980602-37980624 GAGGCTGAGGCCAGGGAGGAGGG + Intronic
1165786493 19:38464813-38464835 GAGGCTGAGGTTAGGGAGGAAGG + Intronic
1165935386 19:39385523-39385545 GAGGGTGAAATCATGGAGGAGGG - Intronic
1166040096 19:40197095-40197117 GAGGGTAAACTGATGGAGGCTGG + Intronic
1166251725 19:41576067-41576089 GAGGCAGGACTGAGAGGGGAGGG + Intronic
1166270145 19:41708520-41708542 GAGGCAGAAATGAGAGGGGAGGG + Intronic
1166281366 19:41796474-41796496 GAGGCAAAACTGAGAGGGGAGGG + Exonic
1166415933 19:42595002-42595024 GAGGCAGGACTGAGAGGGGAGGG - Intronic
1166420590 19:42633208-42633230 GAGGCAGGACTGAGAGGGGAGGG - Intronic
1166432684 19:42740557-42740579 GAGGCAGGACTGAGAGAGGAGGG - Exonic
1166435792 19:42765754-42765776 GAGGCAGGACTGAGAGAGGAGGG - Intronic
1166448654 19:42879754-42879776 GAGGCAGGACTTAGAGAGGAGGG - Intronic
1166453063 19:42917965-42917987 GAGGCAGGACTGAGAGAGGAGGG - Intronic
1166455552 19:42937249-42937271 GAGGCAGAACTGAGAGAGGAGGG - Intronic
1166465337 19:43026546-43026568 GAGGCAGGGCTGAGAGAGGAGGG - Intronic
1166471466 19:43082742-43082764 GAGGCAGGACTGAGAGAGGAGGG - Intronic
1166482609 19:43186577-43186599 GAGGCAGGACTGAGAGAGGAGGG - Intronic
1166485091 19:43205709-43205731 GAGGCAGAACTGAGAGAGGAGGG - Exonic
1166492235 19:43269604-43269626 GAGGCAGGACTGAGAGAGAAGGG - Intergenic
1166537623 19:43584909-43584931 GAGGCTGAAGTGAGCTATGATGG - Exonic
1167071600 19:47225419-47225441 GAGGCTGCACTGAGCCATGAAGG - Intronic
1167383000 19:49149374-49149396 GAGGCTGAGCTGAGGGGGCGGGG + Intronic
1167409487 19:49336663-49336685 GAGGAGGAGCTGAAGGAGGAAGG + Intronic
1167712697 19:51122214-51122236 GAGGCTGAACTGAGATTGGAAGG - Intergenic
1167785201 19:51630276-51630298 GTGAGTGAGCTGAGGGAGGAGGG - Intronic
1167787300 19:51646700-51646722 GTGAGTGAGCTGAGGGAGGAGGG - Intronic
1168263697 19:55209607-55209629 GAGGCAGCGGTGAGGGAGGAAGG - Intergenic
1168383905 19:55946703-55946725 GAGGCTGGAGGGTGGGAGGAGGG - Intergenic
1168479890 19:56710988-56711010 GAGGGTGAAGGGTGGGAGGAGGG - Intergenic
1168521730 19:57056511-57056533 GGGGCAGACCTGAGGGTGGAGGG + Intergenic
1168525053 19:57081982-57082004 GAGGCTGCAGTGAGCTAGGATGG + Intergenic
925018580 2:551291-551313 GAGGCTGCAGTGAAGGAGGTGGG + Intergenic
925093671 2:1176299-1176321 GAGGGTGAAGGGTGGGAGGAGGG + Intronic
925577896 2:5379729-5379751 GAGGGTGAAAGGTGGGAGGAGGG + Intergenic
926159817 2:10479541-10479563 GAGGCCGAACTGAGTGGGGTCGG - Intergenic
926165661 2:10521142-10521164 GAGGCTGGAGGGAGGGAGGGAGG + Intergenic
926412532 2:12619617-12619639 GAGGAAGAAGAGAGGGAGGAGGG - Intergenic
926451163 2:13005935-13005957 GAGGAGGAACAGAGGCAGGAAGG - Intergenic
926744192 2:16137212-16137234 CAGGCTGAGGTGAGGCAGGAGGG + Intergenic
926783610 2:16498545-16498567 GAGGGTGGACGGTGGGAGGAGGG - Intergenic
926878901 2:17518591-17518613 GAGGAGGGACTGAGGGAGGCGGG - Intergenic
927026806 2:19076708-19076730 GAGGCAGTAGTGAAGGAGGAAGG - Intergenic
927573723 2:24182863-24182885 ATGGCTGAACTGAGGGAGGGAGG - Intronic
927695611 2:25237698-25237720 GAGGCTGCAGTGAGCCAGGATGG + Intronic
928704486 2:33933307-33933329 AAAGCAGAACTGAGGGAGGCAGG - Intergenic
928792489 2:34974793-34974815 GGGGCTTAGCTGAGGGTGGAGGG - Intergenic
929135645 2:38621429-38621451 GAGGGTGAAGAGTGGGAGGAGGG + Intergenic
929279863 2:40066052-40066074 GAGGGAGAAGTGAGGGAGAAGGG - Intergenic
929446002 2:42001921-42001943 CAGGCTGAACTGCTGGAGGAAGG - Intergenic
929887568 2:45892506-45892528 CAAGCTGGAGTGAGGGAGGAGGG + Intronic
930032658 2:47068052-47068074 GAGAATGAGCTGAGGGACGAGGG + Intronic
930086362 2:47500253-47500275 GAGGCTCTGCTGAGTGAGGACGG + Intronic
930572725 2:53107422-53107444 GAGGGTGGAGGGAGGGAGGAGGG + Intergenic
930619404 2:53628043-53628065 GACACTGAACTCAGAGAGGATGG - Intronic
931014671 2:57962563-57962585 GAGGATGGAGGGAGGGAGGAGGG - Intronic
931138788 2:59434178-59434200 GAGGACGGACTGAGTGAGGAGGG + Intergenic
931440445 2:62286786-62286808 GTGGATGAAGTGGGGGAGGAGGG - Intergenic
931539897 2:63318763-63318785 GAGGCTGGAGTGTGGGAGGAGGG + Intronic
931546585 2:63394886-63394908 GAGGGTGAAGGGTGGGAGGATGG + Intronic
931933381 2:67166885-67166907 GAGGCTTATCAGAGGGTGGAGGG + Intergenic
932020205 2:68076985-68077007 AAGGCTGAAGTCAGGGTGGAGGG + Intronic
932144087 2:69304007-69304029 AAGGCTCATCTGAGGGAGGAGGG + Intergenic
932243341 2:70175336-70175358 GAGGGTGAAACGTGGGAGGAGGG - Intronic
932278339 2:70468435-70468457 GATGCTGAATTGAGACAGGAAGG + Intronic
932361833 2:71115317-71115339 GAGGCTGAAGTGAGCTATGATGG + Intronic
932454024 2:71834709-71834731 GAGGGTGAACTGAGGGGCAAAGG + Intergenic
932754023 2:74392491-74392513 GAGGCTGAGAGGTGGGAGGATGG - Intergenic
932787248 2:74617525-74617547 GAGGGTGGAGTGTGGGAGGAGGG + Intronic
933319489 2:80755926-80755948 AAGGGTGGAGTGAGGGAGGAGGG - Intergenic
933638138 2:84729444-84729466 AAGGCTGCAGTGAGGAAGGAAGG - Intronic
933898919 2:86835509-86835531 GAGGCTGAGGTAAGGGTGGAGGG + Intronic
934107856 2:88712506-88712528 GAGGGTGAACTGTGAGAGCAAGG - Intronic
935027104 2:99287375-99287397 GAGGGTGGAGTGTGGGAGGAGGG + Intronic
935063234 2:99626375-99626397 GAGGAAGAAGGGAGGGAGGAAGG - Intronic
935213280 2:100956355-100956377 GAGGCTGGAGGGAGGAAGGAAGG - Intronic
935230114 2:101088642-101088664 GAGGCTGCAGTGAGGTATGATGG - Intronic
935287604 2:101579267-101579289 GAGCCTGAAGTGAGGGAGTCAGG + Intergenic
935345350 2:102102996-102103018 GAGGATGGAGTGTGGGAGGAGGG + Intronic
935781627 2:106513717-106513739 GAGGCTGAGGTAAGGGTGGAGGG - Intergenic
935863354 2:107358547-107358569 GGGGCGGTACTGAGGGTGGAGGG + Intergenic
936233567 2:110724931-110724953 AAGGAAGAACGGAGGGAGGAAGG + Intergenic
936778402 2:116002355-116002377 GAGGCTGGACACCGGGAGGAGGG - Intergenic
936783937 2:116069427-116069449 GAGGGTGAAGGGTGGGAGGAGGG + Intergenic
936960037 2:118063258-118063280 GAGGGTGAAGAGTGGGAGGAGGG - Intergenic
937259412 2:120576124-120576146 GAGGCTTAATGGAGGGAGGTAGG - Intergenic
937993558 2:127677139-127677161 TTGGCTGAACTGTGGGAGGCTGG - Intronic
938054956 2:128208028-128208050 GTGGCTGAACTGAGAGGGGGTGG + Intergenic
938067953 2:128292101-128292123 GAGGGTGAACTGAGGCCGGGGGG + Intronic
938716679 2:134027906-134027928 GAGGCTGAGCTGAGGGGGACCGG + Intergenic
939299691 2:140319621-140319643 GAGGGTGAAGGGTGGGAGGAGGG + Intronic
939462901 2:142519619-142519641 GAGGAGGAATTGGGGGAGGAGGG + Intergenic
939877348 2:147592808-147592830 GAGGTTGAAGGGTGGGAGGAGGG - Intergenic
940211273 2:151258634-151258656 GAGGCTGCAGTGAGCCAGGATGG + Intronic
940396920 2:153200180-153200202 GAGGATAAACTGAAGCAGGAAGG + Intergenic
940535876 2:154943671-154943693 GAGTTTGAAATGAGGGATGAGGG - Intergenic
940685484 2:156844937-156844959 GAGGGTGAAGGGTGGGAGGAGGG + Intergenic
940862064 2:158781061-158781083 GAGGGTGAAGGGTGGGAGGAGGG - Intergenic
941497131 2:166219569-166219591 GAGGGTGAAGGGTGGGAGGAAGG + Intronic
941821241 2:169845356-169845378 GAGGCTGCAGTGAGCCAGGATGG + Intronic
942846765 2:180436044-180436066 GAGGGTGAAGGGTGGGAGGAGGG - Intergenic
942917585 2:181330206-181330228 GAGGGTGAAGGGTGGGAGGAGGG + Intergenic
943058821 2:183016786-183016808 GAGGTTGGAGGGAGGGAGGAAGG + Intronic
943483315 2:188449381-188449403 GAGACTCAATTGGGGGAGGAGGG - Intronic
943512237 2:188840464-188840486 GAGGGTGAGCTGAAGTAGGATGG + Intergenic
943533626 2:189119252-189119274 GAGGATGAAGAGAGGAAGGAGGG + Intronic
943972821 2:194432581-194432603 GAGGGTGAAGGGTGGGAGGAGGG + Intergenic
943995962 2:194765883-194765905 GAGGCAGAAGGGATGGAGGATGG - Intergenic
944293069 2:198030149-198030171 GAGGGTGAAGGGTGGGAGGAGGG - Intronic
944391288 2:199222415-199222437 GAGGATGAAGGGTGGGAGGAGGG - Intergenic
944882149 2:204024279-204024301 GAGTATGAAGTGGGGGAGGAGGG + Intergenic
945071340 2:205991926-205991948 GAGGCTGAAGTGAGCCAAGATGG + Intergenic
945608968 2:211974080-211974102 GAGGGTGGACGGTGGGAGGAGGG + Intronic
945752333 2:213803800-213803822 GAGGCTGCAGTGAGCTAGGATGG - Intronic
945854271 2:215049002-215049024 GAGTGTGAAGTGTGGGAGGAGGG + Intronic
945989213 2:216379689-216379711 GAAGATGAAATGAGAGAGGAGGG + Intergenic
946218843 2:218208777-218208799 GAGGGTGAAGGGTGGGAGGAGGG - Intergenic
946394033 2:219434548-219434570 GGGTCTGAGATGAGGGAGGAAGG + Intergenic
946901063 2:224371955-224371977 GAGGGTGAAGTGTGGGAGGAGGG + Intergenic
947190898 2:227503553-227503575 GAGGGAGAAATGAGGAAGGAAGG - Intronic
947434739 2:230063402-230063424 GAGGCTGGAAGGAGAGAGGAGGG - Intronic
947486674 2:230556377-230556399 GAGGCTGCAGTGAGCTAGGATGG + Intergenic
947491748 2:230601843-230601865 GTGGCTGAATCCAGGGAGGAGGG - Intergenic
947744298 2:232499765-232499787 AAGGCTGAAGAGAGGGAGGCTGG - Intergenic
947957746 2:234208739-234208761 GAGGGTGAAGGGTGGGAGGAGGG - Intergenic
948398966 2:237668613-237668635 GAGGGGGAACTGAGGCTGGAAGG - Intronic
948664553 2:239526883-239526905 GAGGCAGAACTTCGGGCGGAGGG - Intergenic
948935608 2:241162368-241162390 GAGAGTGAACTGACAGAGGAGGG + Intronic
948940210 2:241191528-241191550 GTGGCTGAACAGCTGGAGGATGG - Intronic
949043259 2:241858989-241859011 GAGGCAGTGCTGGGGGAGGAGGG + Intergenic
949046324 2:241874138-241874160 GAGGCTACACTGAGGCTGGAGGG - Intergenic
949079064 2:242082222-242082244 GAGGCTGGAGGGTGGGAGGAGGG + Intergenic
1168770432 20:411266-411288 GAGGCTGTAGTGAGCGATGATGG - Intronic
1169074077 20:2750834-2750856 GAGGTTGACCTGGGGAAGGAAGG + Intronic
1169204180 20:3730859-3730881 GAGGCTGAGCAGAGCCAGGAGGG - Intergenic
1169245053 20:4018523-4018545 GAGAATGAACGGAAGGAGGAGGG + Intergenic
1169260497 20:4134829-4134851 GAGGGAGAACTGAAGGAGGAGGG + Intronic
1169424519 20:5485637-5485659 GAGCCTGAACAGAGGGAGAGGGG + Intergenic
1169880160 20:10338692-10338714 GAGGCTGAACTTTTGAAGGACGG - Intergenic
1170594324 20:17793848-17793870 GAGGCTGAGCAGAGGCAGGATGG - Intergenic
1170621160 20:17997455-17997477 ATGGCTGAACAAAGGGAGGAAGG - Intronic
1171225514 20:23439256-23439278 GAGGCTGAAGTGAGCCGGGAGGG - Intergenic
1171227885 20:23456552-23456574 GAGGCTGGGCAGAGGCAGGAAGG - Intergenic
1171440172 20:25154221-25154243 GAGGCTGGAAGGAGGAAGGAAGG - Intergenic
1172119226 20:32588026-32588048 GAGACTGAAGTGAGGGAGGAGGG + Intronic
1172638196 20:36424079-36424101 GAAGCTGACCTGAGATAGGACGG - Intronic
1172967596 20:38848809-38848831 GAGGGTGGATTGTGGGAGGAGGG + Intronic
1173066070 20:39713290-39713312 GAGGCAGGACTAAGGGAAGATGG + Intergenic
1173566318 20:44040959-44040981 GGAGCTGAACTGATGGAGGTGGG + Intronic
1173761787 20:45567888-45567910 GAGGCTGCAGTGAGCTAGGATGG - Intronic
1173807428 20:45934968-45934990 GTGGCCGAAGTGAGGGAGGTGGG + Intronic
1174114467 20:48217510-48217532 GAGGAGGGAGTGAGGGAGGAAGG + Intergenic
1174393292 20:50231398-50231420 CAGGCAGAACAGTGGGAGGAAGG + Intergenic
1174443502 20:50575010-50575032 GAGTCTGAAGAGAGGGAAGAAGG + Intronic
1175091789 20:56510886-56510908 GAGGCTGCACTGAGCCATGATGG + Intronic
1175311334 20:58013674-58013696 GGAGCTGAGCTGAAGGAGGAAGG + Intergenic
1175565546 20:59973539-59973561 GAGGGTGAAGGGTGGGAGGAGGG - Intronic
1175587831 20:60159588-60159610 GAAGCTGAACTGAGACTGGATGG + Intergenic
1175696113 20:61104239-61104261 GATACAGAACTGAGGGAAGAGGG - Intergenic
1175904958 20:62375203-62375225 AAGGCTGAAAGGTGGGAGGATGG + Intergenic
1175914853 20:62421057-62421079 GAGGCCAATCTGTGGGAGGAGGG - Intronic
1176194303 20:63830552-63830574 GAGTCGGAACTGCGGGAGGTGGG - Intronic
1177259182 21:18706909-18706931 GAGGGTGAACAGGGGGAAGAGGG - Intergenic
1177275523 21:18908166-18908188 GAGGCTGAACTGGGGGCAGTGGG + Intergenic
1177721040 21:24907238-24907260 GAGGTTGCAGTGAGGCAGGATGG + Intergenic
1177894854 21:26845849-26845871 AAGAGGGAACTGAGGGAGGAGGG - Intergenic
1178016745 21:28355542-28355564 GAGGGTGAAGAGTGGGAGGAGGG + Intergenic
1178420739 21:32441342-32441364 GAGGCTGAATGAAGGGAGGAAGG + Intronic
1178628422 21:34238296-34238318 GAGGCTGGAGGGTGGGAGGAGGG + Intergenic
1178777553 21:35566551-35566573 GAGGAAGAATAGAGGGAGGAAGG - Intronic
1179222344 21:39419458-39419480 GAGGCTGCAGTGAGCCAGGATGG + Intronic
1179488401 21:41725687-41725709 GAGGCTGAGCTGAGGGGGGTGGG - Intergenic
1179643162 21:42760314-42760336 GACGCAGAACTGCGGGAGGCAGG - Exonic
1179656981 21:42851786-42851808 GAGGCTGAGCAGGGGCAGGATGG - Intronic
1179977337 21:44875856-44875878 GAGAAGGAGCTGAGGGAGGAGGG - Intergenic
1180540968 22:16447367-16447389 GAGGGTGAGCTGAAGCAGGATGG + Intergenic
1180818430 22:18807964-18807986 GAGCCTGAAGTGGGGGAGGGGGG + Intergenic
1180990646 22:19933743-19933765 GATGCTGTTCTGTGGGAGGAAGG + Intronic
1181204652 22:21242419-21242441 GAGCCTGAAGTGGGGGAGGGGGG + Intergenic
1181283434 22:21735880-21735902 GGGGCGGAACGGAGGCAGGATGG - Intergenic
1181295504 22:21835201-21835223 GAGGCTGAACTGAGGGAGGAAGG + Intronic
1181348419 22:22237729-22237751 GAGGCTGAAGTGAGCTATGACGG + Intergenic
1181464534 22:23103794-23103816 CCAGCTGACCTGAGGGAGGAAGG - Intronic
1181511556 22:23391492-23391514 GAGGGTTAACTGAGGGCTGAGGG + Intergenic
1181534389 22:23534125-23534147 GAGGAAGAAGGGAGGGAGGAAGG + Intergenic
1181582625 22:23836650-23836672 GAGGCCACACTGAGTGAGGACGG + Intronic
1182072446 22:27473323-27473345 GGAGTTGAAATGAGGGAGGAAGG - Intergenic
1182454090 22:30438778-30438800 GAGCAGGAACTGAGGGAGGAGGG - Intergenic
1182641679 22:31773250-31773272 GAGGCTGTAGTGAGGCATGATGG - Intronic
1182764626 22:32749803-32749825 GAGACTGAACTGTGGTTGGAAGG + Intronic
1182787077 22:32916995-32917017 GAGGCTCATCTCAGGGAGCAGGG + Intronic
1182787988 22:32923835-32923857 GAGGGTGAAGGGTGGGAGGAGGG - Intronic
1182818961 22:33196776-33196798 GAGGAGGAAAAGAGGGAGGAGGG + Intronic
1182878619 22:33713889-33713911 GAGGCTGCAGTGAGCCAGGATGG + Intronic
1183081368 22:35458804-35458826 GGGGCTCTACTGAGTGAGGAAGG - Intergenic
1183160688 22:36110986-36111008 GAGGCTGCAGTGAGACAGGATGG - Intergenic
1183179904 22:36253005-36253027 GGGGCTGGACTGAAGGTGGAGGG + Intronic
1183348608 22:37321588-37321610 GAGGGTGGACAGTGGGAGGACGG + Intergenic
1183789113 22:40050597-40050619 CAGTCTTAACTGAGGGTGGATGG - Intronic
1183875006 22:40772699-40772721 GAGGCTGTACTGAGCTATGATGG - Intronic
1184002029 22:41682135-41682157 GAGGCTGGACATAGGGTGGACGG + Intronic
1184258520 22:43301255-43301277 GAGGATGGACAGAGGCAGGATGG - Intronic
1184326842 22:43794754-43794776 GAGACTGGAATGGGGGAGGAGGG - Intronic
1184549996 22:45199424-45199446 GAGGCTGCACAGAGCCAGGAGGG + Intronic
1184566058 22:45292841-45292863 GAGGCTGCAGTGAGCCAGGATGG + Intronic
1184690272 22:46114313-46114335 GAAACTGTCCTGAGGGAGGACGG - Intergenic
1203222272 22_KI270731v1_random:52996-53018 GAGCCTGAAGTGGGGGAGGGGGG - Intergenic
949226886 3:1705531-1705553 GAGGGTGAACTGAAGCAGGGTGG + Intergenic
950077393 3:10196687-10196709 CAGGCAGCACTGAGGCAGGAAGG - Intronic
950231170 3:11277139-11277161 GAGCCTGAAATGAGGGAGCAAGG - Intronic
950237709 3:11338100-11338122 GAGGGTGAAGGGTGGGAGGAGGG - Intronic
950369977 3:12520929-12520951 GAGGGTGAAGAGAGGGAGGAGGG - Intronic
950817133 3:15716895-15716917 GAGGCTGAAGTGAGCTATGATGG + Intronic
950888768 3:16384476-16384498 GAGGCTGAAGTGTGGCAGGGAGG + Intronic
951098250 3:18656535-18656557 GAGACTGAAGTGATGAAGGAAGG - Intergenic
951275724 3:20683250-20683272 GAGGGTGAAATGTGGGAGGAGGG + Intergenic
951617705 3:24566884-24566906 GAGGGTGAACTGAAGCAGGCGGG + Intergenic
952307518 3:32159137-32159159 GAGTCTCAAGTGAGGAAGGAGGG - Intronic
953039194 3:39239735-39239757 GAGGGTGAAGGGTGGGAGGAAGG - Intergenic
953745214 3:45568782-45568804 GAGGGTGGAGGGAGGGAGGAGGG - Intronic
953789960 3:45939719-45939741 GAGGCTGACCAGAGGGACGATGG - Intronic
954291755 3:49653634-49653656 GAGGCTGAGCTGGGGGAGGCAGG - Exonic
954495477 3:50955680-50955702 GAGGGTGAAGAGTGGGAGGAAGG + Intronic
954624935 3:52017220-52017242 GAGGCGGAAGTGAGGGGTGAAGG + Intergenic
954840791 3:53509595-53509617 GGGGCTGACCCGAGGGAGGGCGG + Intronic
955217439 3:56996218-56996240 GATGCAGAAATGAGGGAGGGTGG - Intronic
955467227 3:59249875-59249897 CATGCTGAAATGAGGGTGGATGG + Intergenic
955602452 3:60661204-60661226 GAGATTCAAGTGAGGGAGGAGGG - Intronic
956301989 3:67781911-67781933 GAGGGTGAACTGAAGCAGGGTGG - Intergenic
956874107 3:73445032-73445054 TAGGCTGAAGTGAAGCAGGAAGG + Intronic
956913874 3:73850456-73850478 GAGGGTGAAGGGTGGGAGGAGGG - Intergenic
957201853 3:77146278-77146300 GAGGGTGGAGAGAGGGAGGAAGG + Intronic
957335182 3:78818594-78818616 GAGGCTGAACTGGTGGGGCAAGG + Intronic
957444280 3:80294883-80294905 GAGGCTGAGGTGGGGGAGGCGGG - Intergenic
957888310 3:86320313-86320335 GAGGGTGAAGGGAAGGAGGAGGG - Intergenic
957989893 3:87614496-87614518 GAGGAGGAATTGAGTGAGGAGGG + Intergenic
958616054 3:96494430-96494452 GAGGCAGGGCTGAAGGAGGAGGG - Intergenic
958732433 3:97973160-97973182 GAGGCACAAATGAGGGAGCAGGG + Intergenic
959318339 3:104838129-104838151 GAGGGTGAAGGGTGGGAGGAAGG + Intergenic
959564988 3:107825088-107825110 GGGGATGAACTGTGGCAGGATGG + Intergenic
959734043 3:109637363-109637385 GAGGCTGAAGAGTGGGAGGAGGG - Intergenic
959963618 3:112330462-112330484 GAGGCTGAAGTGAGCCATGATGG - Intergenic
960437348 3:117644017-117644039 GAGGGTGAAGGGTGGGAGGAGGG - Intergenic
960884732 3:122382984-122383006 GAGGCTGCTCTGTAGGAGGAGGG - Intronic
961543818 3:127618333-127618355 GAGGCAGAAGTGAGGGAGGTGGG - Intronic
961549244 3:127659210-127659232 GAGGCACAACTGTGGGAGCAAGG - Intronic
961655373 3:128438853-128438875 GAGGCTGAAGTGAGGAGGCAGGG - Intergenic
961981305 3:131081993-131082015 GAGGCTGACCTGAAGGGGAATGG - Intronic
962057825 3:131891565-131891587 GAGGGTGAAAGGTGGGAGGAGGG - Intronic
962626845 3:137234197-137234219 AAGGCTTAACTGGGGGAGGATGG - Intergenic
962953408 3:140242493-140242515 GAGGCTGAACTCAGAGAACAGGG - Intronic
963337789 3:143997120-143997142 GGGGCTTACCTGAGGGAGAAGGG - Intronic
963636721 3:147807181-147807203 GAGGGTGAAGGGTGGGAGGAGGG + Intergenic
963851648 3:150215974-150215996 GAGGGGGAAAGGAGGGAGGATGG + Intergenic
964776928 3:160289301-160289323 GAGGGTGAAGAGTGGGAGGAGGG + Intronic
965166162 3:165196181-165196203 GAGGCGGAAAGGAGGCAGGAAGG + Intronic
965224779 3:165973883-165973905 GGGGCTTAATTGAGGGTGGAGGG + Intergenic
966022545 3:175233504-175233526 GAGGCTGCAGTGAGCTAGGATGG - Intronic
966763748 3:183439892-183439914 GAGGGTGAACTGTGGGAAAAGGG + Intergenic
967562741 3:190935318-190935340 GAGGATGAACTGAAGCAGGTGGG - Intergenic
967640430 3:191856340-191856362 GAGAGTGGACTGTGGGAGGAGGG - Intergenic
967959060 3:194904995-194905017 GAGGGTGGACGGTGGGAGGAGGG - Intergenic
968010638 3:195271639-195271661 GAGGCCGAGCGGAGGGAGGCTGG + Intergenic
968585173 4:1413005-1413027 GGGGCTGCAATGAGGGAAGACGG - Intergenic
969081973 4:4626147-4626169 GAGGCTGCAGTGAGCGATGATGG - Intergenic
969183270 4:5457882-5457904 GAGGCGGAAGGGAGGGAGGGAGG + Intronic
969967088 4:11008068-11008090 GAGGCTGGACAGAGGGAGTGAGG + Intergenic
970044946 4:11841559-11841581 GAGGGTGAACTGAGTAAGCAAGG + Intergenic
970047031 4:11866071-11866093 GAGGGCGAAGGGAGGGAGGAGGG + Intergenic
970056623 4:11980682-11980704 GAGGCTCAACTGAGGCTAGAGGG + Intergenic
970607243 4:17692189-17692211 GAGGGAGAAGTGAAGGAGGAGGG + Intronic
971745759 4:30578061-30578083 AAGAGTGAAATGAGGGAGGAAGG - Intergenic
971890099 4:32508611-32508633 GAGTCTGAAGGGAGGGGGGATGG + Intergenic
973561198 4:52137899-52137921 GAGGGTGAAGTTTGGGAGGAGGG + Intergenic
973818618 4:54642048-54642070 GAGGCGGGAATGATGGAGGATGG + Intergenic
974107508 4:57486870-57486892 GAGGCTGCAGTGAGGCAAGATGG + Intergenic
974239760 4:59231658-59231680 GAGGGTGGACGGTGGGAGGATGG - Intergenic
974370269 4:61007591-61007613 GAGGATGAAAAGAGGGAGGTAGG + Intergenic
974544375 4:63281136-63281158 GAGGCTGAAATGTGGGAAGGAGG + Intergenic
974881777 4:67767484-67767506 GAGGGTGAAAGGTGGGAGGAAGG - Intergenic
975022668 4:69508703-69508725 GAGGCTGAAGAGCGGGAGGAGGG + Intronic
975093448 4:70429598-70429620 GAGGGTGAAGGGTGGGAGGAAGG + Intergenic
975117465 4:70695538-70695560 GAGGCTGCAGTGAGGCATGATGG + Intergenic
975585393 4:75943098-75943120 GTGGCTTAGCTGAGGCAGGAAGG - Intronic
976126079 4:81835053-81835075 AAGGAGGAACAGAGGGAGGAAGG + Intronic
976327416 4:83787749-83787771 GAGGAAGAACTGGGGAAGGATGG + Intergenic
976503652 4:85820484-85820506 GAGGCTGGAAGGAGGGAGCAGGG + Intronic
976834690 4:89357805-89357827 GAGAGTGAACTGATGGAGAAAGG - Intergenic
976914074 4:90348115-90348137 GAGGCTGGAGGGTGGGAGGAGGG + Intronic
976915459 4:90368565-90368587 GAGGCTGAAGTGAGCCATGATGG + Intronic
976947945 4:90793325-90793347 GAGGCTGCAGGGTGGGAGGAGGG - Intronic
977345735 4:95813860-95813882 GCAGCTGAAATGAGGGAAGATGG + Intergenic
978402901 4:108349717-108349739 GAGGCTGAGGTGAGGGAGGTGGG + Intergenic
978769743 4:112442464-112442486 GAGGGTGGACAGTGGGAGGAGGG + Exonic
979045672 4:115859578-115859600 GAGGGTGAAAGGTGGGAGGAGGG + Intergenic
979279781 4:118852717-118852739 GAGGCTGGAGGGTGGGAGGAGGG + Intronic
979301114 4:119088463-119088485 GAGGGTGATGGGAGGGAGGAGGG - Intergenic
980154296 4:129085855-129085877 GAGGGTGAAGGGTGGGAGGAGGG + Intronic
980746813 4:137028757-137028779 GAGGCTGGAGTGTGGGACGAGGG - Intergenic
981062771 4:140444373-140444395 GGGGCTTACTTGAGGGAGGATGG - Intronic
981902652 4:149884909-149884931 GAGTCTGAAGGGAGGGAGGAGGG + Intergenic
982144227 4:152365189-152365211 GACACTGAACAGAGGTAGGATGG + Intronic
982677341 4:158390849-158390871 GAAGCCTAACTGAGGGTGGAGGG + Intronic
983500980 4:168499339-168499361 GAGGCAGAAGGGAGGGAGGGGGG + Intronic
983524637 4:168748662-168748684 GAGGCTCAACTGGGGAAGAATGG + Intronic
983746413 4:171205542-171205564 GAGGATGGAGTGTGGGAGGAGGG + Intergenic
983833358 4:172359353-172359375 GAGGGTGAAGGGTGGGAGGAGGG + Intronic
984812563 4:183807691-183807713 GAGGCTGAGCTGGGGGAGGTGGG + Intergenic
984881616 4:184414444-184414466 GAGGCTGAGGTGTAGGAGGATGG - Intronic
984911690 4:184679710-184679732 GAGGCGGAGCTGAGGTGGGAAGG - Intronic
984933330 4:184867713-184867735 GAGGCTGCAGTGAGTGATGATGG - Intergenic
984946309 4:184971329-184971351 GAGGCTGAGCTCAGCGAGGTGGG - Intergenic
984957477 4:185059926-185059948 GAGGCTGCAGTGAGCCAGGATGG - Intergenic
985092399 4:186377810-186377832 GAGGGTGGAGGGAGGGAGGAGGG - Intergenic
985095594 4:186409507-186409529 GGGGAGGAAATGAGGGAGGAGGG + Intergenic
985214615 4:187637641-187637663 GAGGGTGAAGAGAGGGAGGAGGG - Intergenic
985710661 5:1426775-1426797 GGGGCTGCAGTGAGGGAGGATGG + Intronic
985837068 5:2279412-2279434 TATGCAGACCTGAGGGAGGAAGG + Intergenic
985970372 5:3373463-3373485 GAGGATCAACTGAGGGACAAAGG + Intergenic
985993812 5:3585064-3585086 GAGGAGGAAAAGAGGGAGGAGGG + Intergenic
985997423 5:3604761-3604783 GAAGCTGGAGTGAGGGAGGGAGG + Intergenic
986192352 5:5509286-5509308 CAGAGTGAACTGAGGTAGGAGGG + Intergenic
986241426 5:5963417-5963439 GAGGGTGAACTGAAGCAGGCAGG + Intergenic
986621215 5:9677255-9677277 GAGGGTGAAGGGTGGGAGGAGGG + Intronic
986796521 5:11218022-11218044 GAGGAAGAAGGGAGGGAGGAAGG - Intronic
986908758 5:12527704-12527726 GAGGGTGGAGTGTGGGAGGAGGG - Intergenic
987002164 5:13670751-13670773 GAGGGTGGAGTGTGGGAGGAGGG + Intergenic
987446881 5:18031191-18031213 GAGGGTGAAGGGTGGGAGGAGGG - Intergenic
987643628 5:20643343-20643365 GGGGCCTAACTGAGGGTGGAAGG + Intergenic
987939287 5:24511983-24512005 GAGGCTGGAGGGTGGGAGGAGGG + Intronic
988548198 5:32176710-32176732 GGGGAAGAAGTGAGGGAGGAAGG + Intergenic
988689028 5:33553713-33553735 GAGGGTGGAGTGTGGGAGGAGGG + Intronic
988906378 5:35794903-35794925 GAGGGGGACCTGAGGGCGGAAGG - Intronic
989108202 5:37883126-37883148 TAGGATGAAGAGAGGGAGGAAGG + Intergenic
989251405 5:39319740-39319762 GAGGCTGAACTCATGAAGGCTGG - Intronic
989441178 5:41474065-41474087 GAGACTGAACAAAGGGATGAAGG + Intronic
989451878 5:41596466-41596488 GAGGGTGAGCTGAAGCAGGATGG + Intergenic
989475581 5:41869910-41869932 GGGTCTGAACGGGGGGAGGAGGG - Intronic
989509544 5:42268957-42268979 GAGGGTGAAGGGTGGGAGGAAGG + Intergenic
989570191 5:42938773-42938795 GAGGCTGAAGTGAGATATGATGG + Intergenic
990731078 5:58810144-58810166 GAGACTGGACTGAAGGAGGAGGG - Intronic
990823947 5:59875959-59875981 GAGGCTGGAGGGTGGGAGGAGGG + Intronic
990998782 5:61761093-61761115 GAGGGTGAAGGGAGGGAGGAGGG + Intergenic
991183183 5:63778187-63778209 GAGGCTGGAGGGTGGGAGGAAGG - Intergenic
991257352 5:64629742-64629764 GAGCCTGACAGGAGGGAGGAGGG + Intergenic
991362386 5:65833974-65833996 GAGGCTGCAGTGAGCGATGATGG + Intronic
991406525 5:66305711-66305733 GAAGCTGAACTGAGGGACAGAGG + Intergenic
991497910 5:67245638-67245660 GCGGCAGAAATGAGGAAGGAAGG + Intergenic
991680366 5:69133896-69133918 GAAGCTGAAATGAGAGAGGATGG + Intergenic
992032352 5:72734437-72734459 GAGGGTGAAGGGTGGGAGGAGGG - Intergenic
992426952 5:76667681-76667703 GAGGCTGAAGAGAGGGGTGAAGG - Intronic
992950261 5:81851310-81851332 GAGGTGGATCAGAGGGAGGAAGG + Intergenic
993219702 5:85076405-85076427 GAGGGTGGAGTGTGGGAGGAGGG - Intergenic
993278638 5:85896222-85896244 GAGGCTTACTTGAGGGTGGATGG - Intergenic
993347059 5:86797485-86797507 GAGGATGGAGTGTGGGAGGAGGG - Intergenic
993866810 5:93205591-93205613 GAGACAGAATTGAGGGAGGTAGG + Intergenic
994348260 5:98714341-98714363 GAGGCCTACCTGAGGGTGGAGGG - Intergenic
994435186 5:99720594-99720616 GAGGCAGAAGAGTGGGAGGAAGG + Intergenic
994501400 5:100583183-100583205 TAGGCTGAAGAGAAGGAGGAAGG + Intronic
994558465 5:101334617-101334639 GAGGGTGGAATGTGGGAGGAGGG + Intergenic
994842613 5:104946086-104946108 GAGGGTGGACAGTGGGAGGAGGG - Intergenic
995151580 5:108853891-108853913 TAGTCTGAAATGAGAGAGGAAGG + Intronic
995253346 5:110018795-110018817 GGGGCTGAGCTGTGGAAGGATGG + Intergenic
995443161 5:112214136-112214158 GAGTCTGAGCTGATGTAGGAGGG - Intronic
995516576 5:112960157-112960179 GAGGTTGGAGTGAGGGTGGAGGG + Intergenic
995789442 5:115868915-115868937 GAGGATGAAGGGAGGGAGGGAGG + Intronic
996053645 5:118960912-118960934 GAGGCCTAATTGAGGGTGGAGGG + Intronic
996159692 5:120147178-120147200 GAGGGTGGAGTGTGGGAGGAGGG + Intergenic
996312518 5:122122820-122122842 GAGGCTGAATTGAGGGCCCATGG - Intergenic
997076150 5:130680225-130680247 GAGGGTGAAGTGTGGGAGAAGGG - Intergenic
997380830 5:133436369-133436391 GAGGATGACCTGTGGCAGGAAGG + Intronic
997528880 5:134570224-134570246 GACGCTGTCCTGAGGGAGGCAGG - Intronic
997681090 5:135751212-135751234 GGGCCTGAGCTGAGGCAGGAGGG - Intergenic
997815068 5:137008867-137008889 GAGGCTAAACTGGGGGAGAAGGG + Intronic
998579290 5:143354377-143354399 GTGGCTAAACTTAGTGAGGAAGG - Intronic
999322549 5:150624574-150624596 GAGGCTGAGCGGGTGGAGGAGGG + Intronic
999462621 5:151770671-151770693 GAGGCCGAGCTGAAGGAGCACGG - Exonic
999742682 5:154568540-154568562 GAGGCTGGACTGGGGGTGGGAGG + Intergenic
999831289 5:155322588-155322610 GAGGTTGAGGTGAGGGAGGGAGG + Intergenic
1000071712 5:157745917-157745939 GAGGGTGAAGGGTGGGAGGAGGG + Intronic
1000146786 5:158461256-158461278 AAGACTGTACTGATGGAGGAGGG + Intergenic
1000165631 5:158645796-158645818 GGGGCTTACCTGAGGGTGGAGGG + Intergenic
1000574791 5:162964661-162964683 GAGGGTGAGCTGAAGCAGGATGG - Intergenic
1000734257 5:164879401-164879423 GAGGGTGAAGGGTGGGAGGAGGG + Intergenic
1001429139 5:171645832-171645854 GGGCCTGGGCTGAGGGAGGAAGG + Intergenic
1001471861 5:172019965-172019987 GAGGCTGAAGTGAGCCAAGATGG - Intergenic
1001849038 5:174947103-174947125 GAGGGTGAAGGGTGGGAGGAGGG + Intergenic
1001898896 5:175406173-175406195 GAGGGTGGACGGTGGGAGGAGGG - Intergenic
1001931944 5:175679357-175679379 GAGGTAGAAGTGAGAGAGGATGG + Intronic
1002076756 5:176712964-176712986 GAGGCTGTAGTGAGAGAGGAGGG + Intergenic
1002340733 5:178515263-178515285 GAGGCTGCAGGGAGGGAGGCTGG - Intronic
1002424666 5:179168008-179168030 GAGGCTGGTCTGAGGCAGGAGGG - Intronic
1002492458 5:179588378-179588400 GAGGCTGGAATGAGGAGGGATGG + Intronic
1002571319 5:180140772-180140794 GTGGCTGCACTGAGGGCTGACGG + Intronic
1003074072 6:2968305-2968327 GAGGGTGAAGGGTGGGAGGAGGG + Intronic
1003276871 6:4660957-4660979 GAGACGGAACTGTGGGAGGAAGG - Intergenic
1003456463 6:6287310-6287332 TGGTCTGAACTCAGGGAGGACGG - Intronic
1003535003 6:6969100-6969122 GAGGGTGCCCTGAGGGAGGGAGG - Intergenic
1003751274 6:9059753-9059775 GAGGGTGAGATGAGGCAGGAGGG + Intergenic
1004205470 6:13587853-13587875 GAAGGTGAACTGGGGGAGGAAGG + Intronic
1004721220 6:18268926-18268948 GAGTCTGAGCTGAGTAAGGAGGG + Intergenic
1004885074 6:20043358-20043380 GGGGCTTACCTGAGGGTGGAGGG - Intergenic
1006491942 6:34395105-34395127 GAGGCTTAACTAAAGGAGGCTGG + Intronic
1006525034 6:34597002-34597024 GAGGATGTATGGAGGGAGGAGGG - Intronic
1006620280 6:35359163-35359185 GTGGCTGGACAGAGGGAGGGAGG + Intronic
1006646361 6:35517313-35517335 GAGGCTGAAGCGGGGAAGGATGG - Intergenic
1006790363 6:36697430-36697452 GGGCCTGAAGTGAGGCAGGATGG + Intergenic
1006798558 6:36745535-36745557 GAGGCTGAGCCCAGGAAGGAAGG + Intronic
1007983625 6:46185305-46185327 CAGGCAGAGCTGAGGGAGGAAGG - Intergenic
1008194437 6:48501046-48501068 GAGGCTGCACTGAGCCAAGATGG - Intergenic
1008323975 6:50154302-50154324 GAGGGTGGATGGAGGGAGGAGGG - Intergenic
1008457743 6:51730925-51730947 GAGGTTGAAGGGAGGGAAGAGGG + Intronic
1008531180 6:52461212-52461234 GAGGGTGAAGGGTGGGAGGAGGG - Intronic
1008642466 6:53478664-53478686 GAGGGTGAAGGGTGGGAGGAGGG - Intergenic
1008764434 6:54894098-54894120 GAGGCTTAACTTAAGGATGAGGG + Intronic
1009247394 6:61256190-61256212 GAGGCTGGAGGGTGGGAGGAGGG - Intergenic
1009609307 6:65919583-65919605 GAGGGTGGAGTGTGGGAGGAGGG - Intergenic
1009945597 6:70338768-70338790 GAGGGTGAAGGGTGGGAGGAGGG - Intergenic
1009988155 6:70806476-70806498 GAGGGTGAGCTGAAGGAGGGCGG - Intronic
1010298657 6:74232087-74232109 GAGGAGGAAGGGAGGGAGGAAGG - Intergenic
1010996608 6:82540708-82540730 GAGGCCTAATTGAGGGCGGAAGG - Intergenic
1011253561 6:85398757-85398779 GAGGCCTACCTGAGGGTGGAGGG + Intergenic
1012258378 6:97060381-97060403 GAGGATGAGCTGAAGAAGGAGGG + Intronic
1012322476 6:97867523-97867545 GAGGGTGAAGGGTGGGAGGAGGG + Intergenic
1012325227 6:97908316-97908338 GAGGGTGAAGGGTGGGAGGAGGG - Intergenic
1012499710 6:99875131-99875153 GAGGCTGCAATGAGGGAAGTGGG + Intergenic
1012540134 6:100353071-100353093 GAGGGTGAAGGGTGGGAGGAGGG - Intergenic
1012591454 6:100986004-100986026 GAGGGTGAAGGGTGGGAGGAGGG + Intergenic
1012630305 6:101458490-101458512 GAGGCTGCACTGCAGGAGGCTGG - Intronic
1012727324 6:102831016-102831038 GAGGGTGAAGGGTGGGAGGAGGG + Intergenic
1013637691 6:112044699-112044721 GAGGCTGGACTGGGGGAGGTAGG + Intergenic
1013657509 6:112260953-112260975 GAGTCTGAACTGATGGGAGAAGG + Intergenic
1013738407 6:113254583-113254605 GAGGTTGAAGGGTGGGAGGAAGG + Intergenic
1013964990 6:115944868-115944890 GAGGGTGAAGGTAGGGAGGAAGG - Intronic
1014005354 6:116411430-116411452 CAGGCTGCACTCTGGGAGGAGGG + Intronic
1014889995 6:126832538-126832560 GAGGTTGAAGGGTGGGAGGAGGG - Intergenic
1015128684 6:129785349-129785371 CTGGGTGAACTGAGGGTGGATGG + Intergenic
1015311416 6:131771019-131771041 GAGGCAGAAGGGAGGGAGGTGGG + Intergenic
1015536432 6:134271754-134271776 GAGGGTGAAGAGTGGGAGGAGGG - Intronic
1016562636 6:145414142-145414164 AAGGCAGAACTGAGTGTGGAAGG - Intergenic
1017266131 6:152448775-152448797 GAGGCTGAAGTGAGCTATGAAGG + Intronic
1017357039 6:153521464-153521486 GAGGGTGAGCTGAAGCAGGAGGG - Intergenic
1017431656 6:154377120-154377142 GAGGCTGCAGTGAGGCATGATGG + Intronic
1017545919 6:155450617-155450639 GAGGCTGCGCTGGGGGAGGTAGG + Intronic
1017609361 6:156168059-156168081 CAGGCTGGAGGGAGGGAGGAAGG + Intergenic
1017611641 6:156193049-156193071 GGGGCCTACCTGAGGGAGGAGGG - Intergenic
1017734980 6:157354609-157354631 GAGGCTGAACAGTGGGAGGATGG - Intergenic
1017788585 6:157775919-157775941 GAGGATGGAATGAGGGAGGTTGG + Intronic
1018037582 6:159894352-159894374 GAGGCTGAATTGAGTGGAGATGG + Intergenic
1018151429 6:160943671-160943693 GAGGCTGCAGTGAGGCAAGATGG - Intergenic
1018282852 6:162206589-162206611 AGGGCTGAACTGAGGGAATATGG - Intronic
1018347745 6:162920188-162920210 AAGGAGGAAGTGAGGGAGGAAGG + Intronic
1018410573 6:163542241-163542263 GAGGATTAACGGAAGGAGGAAGG - Intronic
1018414341 6:163588507-163588529 GAAGCTTAACCGAGGGAGCAGGG - Intergenic
1018583016 6:165324072-165324094 TTGCCTGAACTGAGGAAGGAAGG - Intergenic
1019071976 6:169354150-169354172 GAGGGTGAGCTGAAGGAGGGTGG - Intergenic
1019260824 7:81026-81048 GGGGCTGATCAGAGGGAGGCCGG - Intergenic
1019469160 7:1209105-1209127 GAGGCTGCAGTGAGGCATGATGG + Intergenic
1019549614 7:1595416-1595438 GAGGATGGATGGAGGGAGGATGG - Intergenic
1019626581 7:2018917-2018939 GTGGCTGAGCTGAGGTGGGATGG - Intronic
1021164923 7:17325793-17325815 GAGGCTGCAGGGTGGGAGGAGGG + Intronic
1021386134 7:20033176-20033198 GAGGTAGGAATGAGGGAGGAAGG + Intergenic
1021824369 7:24533405-24533427 GAGGGTGAAGGGTGGGAGGAGGG - Intergenic
1021853342 7:24830081-24830103 GAGGTAGAACTGAGGTAGGACGG + Intronic
1021889932 7:25177950-25177972 GAGGGTGGAGAGAGGGAGGAAGG - Intronic
1021913132 7:25406082-25406104 GAGGCAGGAATGAGAGAGGAGGG + Intergenic
1022128750 7:27382632-27382654 GAGGTTGCAGTGAGCGAGGATGG - Intergenic
1022228743 7:28392122-28392144 GAGGGTGGACGGAGGGAGGAAGG + Intronic
1022754584 7:33272198-33272220 GAGGTTGAAAGGTGGGAGGAGGG + Intronic
1022756678 7:33300229-33300251 GAGACTGGAGAGAGGGAGGAAGG - Intronic
1022791147 7:33690485-33690507 GAGGCTGAAGTCAGGGAGACAGG - Intergenic
1022951390 7:35341590-35341612 AAGGTTAAACTTAGGGAGGAAGG + Intergenic
1023016046 7:35969146-35969168 GAGGCTGCAGTGAGCCAGGATGG + Intergenic
1023093730 7:36640013-36640035 GAGGCTGTGCTGAGGCGGGATGG + Intronic
1023419874 7:39967967-39967989 GAGGCTGAAGTGGGTGAGGTGGG - Intronic
1024998604 7:55295208-55295230 GAGGGTGAACTGAAGCAGGGTGG - Intergenic
1025789223 7:64672108-64672130 GAGGCCTAGCTGAGGGTGGAAGG - Intronic
1026004782 7:66592085-66592107 GAGGCTGGAATGTGGGACGAAGG + Intergenic
1026992367 7:74594313-74594335 GAGGCTGCAGTGAGCTAGGATGG + Intronic
1028078779 7:86548247-86548269 GAGGATGAGCTGAAGCAGGATGG - Intergenic
1028170326 7:87588324-87588346 GAGGGTGGAGTGTGGGAGGAGGG - Intronic
1028604418 7:92640084-92640106 GAGGCTGAAGTCAGGAGGGAAGG + Intronic
1029250109 7:99230097-99230119 GAGGCCTACCTGAGGGTGGAGGG - Intergenic
1029306018 7:99620585-99620607 GAGGCTGAACTACAGAAGGACGG - Intronic
1029389932 7:100268329-100268351 GAGGCTGCAGTGAGGTATGATGG + Intronic
1029510529 7:100991962-100991984 GAGCCTGAACTGATGGGTGAGGG - Exonic
1029648021 7:101870216-101870238 GAGGCTGCAGTGAGCTAGGATGG - Intronic
1029813642 7:103073416-103073438 GAGGCTGCAGTGAGCTAGGATGG + Intronic
1030022724 7:105291663-105291685 GAGGCTGCACTGAGCCAAGATGG + Intronic
1030280492 7:107769576-107769598 GAGGGTGAAGGGTGGGAGGAAGG + Intronic
1030732443 7:113006022-113006044 GAGGGTGAAGGGTGGGAGGAGGG + Intergenic
1030844591 7:114393467-114393489 GAGTCTGACCAGAGAGAGGAGGG + Intronic
1031046949 7:116901510-116901532 GAGGATGAAGGGTGGGAGGAGGG + Intronic
1031081785 7:117265135-117265157 GAGGCAGGAGAGAGGGAGGAGGG - Intergenic
1032080081 7:128854333-128854355 GAGGTTTAACTGATGGGGGAGGG + Intronic
1032685063 7:134224543-134224565 GAGGGTGAAGGGTGGGAGGAGGG + Intronic
1032775046 7:135104058-135104080 GAGGGTGAAGGGTGGGAGGAGGG - Intronic
1032778279 7:135138735-135138757 GAGGGTGAAGGGTGGGAGGAGGG - Intronic
1033537890 7:142328839-142328861 GAGTCTGGGGTGAGGGAGGAGGG - Intergenic
1033807111 7:144966977-144966999 GAGGGTGAAGGGTGGGAGGAGGG + Intergenic
1034577499 7:152013191-152013213 GAGGGTGGACTGTGGGAGGAGGG + Intronic
1034577668 7:152015023-152015045 GAGGGTGGACTGTGGGAGGAGGG + Intronic
1034820461 7:154211982-154212004 GCAGCTGAGATGAGGGAGGAAGG - Intronic
1035537325 8:402228-402250 GAGGCTGGAGGGTGGGAGGAGGG + Intergenic
1035813582 8:2513985-2514007 GAGGCTGCAGTGAGCCAGGATGG + Intergenic
1036208452 8:6822794-6822816 GTGCCTAGACTGAGGGAGGAGGG + Intronic
1036481893 8:9147385-9147407 GGGTGTGAACTGAGGGAGGAAGG + Intronic
1036571135 8:9980558-9980580 GAGGAGGGATTGAGGGAGGAGGG - Intergenic
1037208832 8:16360313-16360335 GAGACTAAAGAGAGGGAGGAGGG + Intronic
1037491766 8:19403004-19403026 GAGGGTGGACTGTGGGAGGAGGG + Intergenic
1037554660 8:20010505-20010527 GAGGCTGAAGGGTAGGAGGAGGG - Intergenic
1037564480 8:20105935-20105957 AAGGCTGCACAGAGGGAGAAGGG + Intergenic
1037617740 8:20534666-20534688 GAGGGTGAAAGGTGGGAGGAGGG - Intergenic
1038461285 8:27719379-27719401 GAGGGTGAAGAGTGGGAGGAGGG + Intergenic
1038519119 8:28214418-28214440 GAGGGTGAAGGGTGGGAGGAGGG - Intergenic
1038647092 8:29370939-29370961 GAGGCTGCAGTGAGCCAGGATGG + Intergenic
1038787463 8:30632043-30632065 GAGGCTGCAGTGAGCCAGGATGG + Intronic
1038884882 8:31652264-31652286 GAAGTTGAAGTGAGGGAAGACGG - Intronic
1039080937 8:33733422-33733444 GACGCTGAAGGAAGGGAGGAAGG - Intergenic
1039375015 8:37024356-37024378 GAAGCAGAAGTGAGGGAGGAAGG + Intergenic
1039839694 8:41284916-41284938 GTGTCTGACCTGAGGGAAGAAGG - Intronic
1039994661 8:42521552-42521574 GAGGCTGCAGTGAGCGATGATGG - Intronic
1040402942 8:47071119-47071141 GAGGCTGCAGTGAGTGGGGATGG - Intergenic
1040538205 8:48328233-48328255 GAGGCTGGAGGGTGGGAGGAAGG + Intergenic
1040549687 8:48428545-48428567 GAGGGTGAACCAAGGAAGGAGGG + Intergenic
1040619152 8:49070242-49070264 GAGGGTGAAGGGCGGGAGGAGGG + Intronic
1040911589 8:52524583-52524605 GAGGGTGAAGCGTGGGAGGAAGG - Intergenic
1040926851 8:52693778-52693800 GAGGGTGAAGGGTGGGAGGAGGG + Intronic
1040968890 8:53112787-53112809 GAGGGTGAGCTGAAGCAGGATGG - Intergenic
1041220106 8:55642240-55642262 GAGGCTGGAGGGTGGGAGGAAGG - Intergenic
1041449373 8:57991189-57991211 GAGTCTGATCTGAGGGCTGAGGG + Intergenic
1041711228 8:60896333-60896355 GAGGCTGAACAGTGGGAGTATGG - Intergenic
1041738655 8:61136685-61136707 GAGGGTGGAGTGTGGGAGGAGGG + Intronic
1042151034 8:65784142-65784164 GAGGCTGCAGTGAGCTAGGATGG + Intronic
1042433839 8:68741080-68741102 GAGGGTGAAGGGAGGGAGGGGGG + Intronic
1042462101 8:69081381-69081403 TAGCCTGAACTGAGTGTGGAAGG + Intergenic
1042530334 8:69808315-69808337 GAGGGTGAAGTGTGGGAGGAGGG - Intronic
1042600618 8:70495870-70495892 GAGGCTGCAGTGAGCTAGGATGG - Intergenic
1042653687 8:71070836-71070858 GAGGCTGAGATCAGGGAGTAGGG - Intergenic
1042701421 8:71618961-71618983 GAGGCTGAAGAGAAAGAGGAGGG - Intergenic
1043445316 8:80313844-80313866 GAGGATGAAGTGGGAGAGGAGGG - Intergenic
1044062837 8:87661240-87661262 GTCCCTGAACTGAGAGAGGAAGG + Intergenic
1044065410 8:87692960-87692982 GAGGGTGGAGTGTGGGAGGAGGG - Intergenic
1044242782 8:89906421-89906443 GAGGATGAAGGGTGGGAGGAGGG - Intronic
1044499518 8:92936459-92936481 GAGGATGAACAGAGGGAGGCAGG + Intronic
1044545957 8:93459672-93459694 GAGGGTGGACGGTGGGAGGAGGG - Intergenic
1045591391 8:103602448-103602470 GAGGGTGAAGAGTGGGAGGAGGG - Intronic
1045948842 8:107829074-107829096 GAGCTTGCAGTGAGGGAGGAAGG + Intergenic
1046072029 8:109267267-109267289 GAGGGTGGAGGGAGGGAGGAGGG - Intronic
1046584046 8:116129672-116129694 GAGGCTGAGAAGAGGGAGAAGGG + Intergenic
1046736470 8:117781469-117781491 GAGGGTGAAGGGTGGGAGGAGGG + Intergenic
1047306763 8:123658989-123659011 GATGATGAATTGATGGAGGAGGG - Intergenic
1047433284 8:124812028-124812050 GAGGCTGGAGAGTGGGAGGAGGG - Intergenic
1047541782 8:125774642-125774664 GAGGCTGAATGGCAGGAGGATGG - Intergenic
1047734010 8:127750155-127750177 GAGGGAGAAGGGAGGGAGGAAGG - Intergenic
1047896585 8:129373222-129373244 AAGGCTGCAGTGAGGGAGGAGGG - Intergenic
1047979993 8:130171208-130171230 AAGGCTGAAGTGGGGAAGGATGG - Intronic
1048011600 8:130461490-130461512 GAGGCTGAGATGAGGGAGTAAGG + Intergenic
1048336085 8:133503512-133503534 GGGGCTGGACGGAGGGAGGAAGG - Intronic
1048436083 8:134419164-134419186 GAGGATGGACAGTGGGAGGAGGG + Intergenic
1048730829 8:137438828-137438850 TAGGCTGAACTCATGGATGAAGG + Intergenic
1049011116 8:139888129-139888151 GATTCTCTACTGAGGGAGGACGG - Intronic
1049212938 8:141395043-141395065 GAGCCTGAGCAGAGGGTGGAGGG + Intronic
1049240792 8:141536511-141536533 GAGGCAGAACGGGGGGTGGAGGG - Intergenic
1049974110 9:845639-845661 GAGGCTGAAGGCAGGGAGGAAGG - Intronic
1050013157 9:1205955-1205977 GAGGCAGTAGAGAGGGAGGAGGG + Intergenic
1050290161 9:4145730-4145752 GAGGGGGAACAAAGGGAGGAGGG - Intronic
1050318728 9:4429293-4429315 GAGGCTGGAGAGAGGGAGGTAGG - Intergenic
1050359627 9:4817536-4817558 GAGGCTGAAGTGAGCCATGATGG - Intronic
1051183726 9:14437949-14437971 GAGGCAGGACTCTGGGAGGAGGG - Intergenic
1051599474 9:18858376-18858398 GAGGCTGAACAGAGTGAAAAGGG - Intronic
1052276327 9:26680746-26680768 GAGGCTGCAGTGAGTGATGACGG - Intergenic
1052632974 9:31064521-31064543 GAGGCTGGTGTTAGGGAGGATGG + Intergenic
1053462584 9:38282021-38282043 GAGGCTGAGCAGAGGGCAGAGGG + Intergenic
1053469080 9:38332764-38332786 GGGGCTGAGGTGCGGGAGGAGGG + Intergenic
1053804214 9:41784661-41784683 GAGGCTTAATTGTGGCAGGAGGG + Intergenic
1054141068 9:61530798-61530820 GAGGCTTAATTGTGGCAGGAGGG - Intergenic
1054192522 9:61996157-61996179 GAGGCTTAATTGTGGCAGGAGGG + Intergenic
1054645883 9:67592534-67592556 GAGGCTTAATTGTGGCAGGAGGG - Intergenic
1054878059 9:70117020-70117042 GAAGCTGACCTGAGGGCTGAAGG + Intronic
1055233943 9:74096232-74096254 GAGGCTGAACTGAGCTGTGATGG + Intergenic
1055651587 9:78411490-78411512 GGGACTGAACTGAGGGTGAAGGG + Intergenic
1055733427 9:79302853-79302875 GAAGGTGAACTGAGGAAGTAGGG - Intergenic
1055874967 9:80931468-80931490 GAGGCTGGAGGGTGGGAGGAGGG + Intergenic
1056150192 9:83778543-83778565 GAGGGTGAAGGGTGGGAGGAGGG + Intronic
1056999789 9:91497206-91497228 GCGGCTGACAGGAGGGAGGATGG - Intergenic
1057380685 9:94564660-94564682 GAGGGTGGAGGGAGGGAGGAGGG + Intronic
1057519763 9:95751729-95751751 GAGCCTGAGCTGCGGGAGGTAGG + Intergenic
1058174356 9:101720848-101720870 GAGGGTGAAGAGTGGGAGGAGGG + Intronic
1058503835 9:105649046-105649068 GAGGTTGGAATGAGGGAGGCAGG + Intergenic
1058597676 9:106632206-106632228 GAGGGTGCAATCAGGGAGGAAGG + Intergenic
1058896251 9:109403011-109403033 GAGGCTGAAGTGAGCCAAGATGG + Intronic
1058903786 9:109464402-109464424 GAGGGTGAAGTGTGGGAGGAGGG + Intronic
1058948479 9:109881028-109881050 GAGGGTGAAGGGAGGGAGGAGGG - Intronic
1059080387 9:111242959-111242981 GGGGCTTACCTGAGGAAGGAGGG + Intergenic
1059896416 9:118871127-118871149 GAGGGTGAAGGGTGGGAGGAGGG - Intergenic
1060821099 9:126661966-126661988 GAGGCGGAACTGCAGCAGGAAGG + Intronic
1060998697 9:127889994-127890016 GAGGCTGCAGTGAGCCAGGATGG - Intronic
1061427337 9:130507558-130507580 GAGGCTGCAGTGAGGCAAGACGG - Intergenic
1061492592 9:130954330-130954352 AAGGCTGAAATGAGGGAGGCAGG - Intergenic
1061908873 9:133712479-133712501 GGGGCAGCAGTGAGGGAGGAAGG - Intronic
1062049123 9:134438129-134438151 GTGCCTGAACAGAGGGTGGATGG + Intronic
1062109448 9:134773959-134773981 GAGGCTGTGCCCAGGGAGGAGGG - Intronic
1062144736 9:134982750-134982772 GAGGTTGTACTGAGGGGGGGTGG - Intergenic
1062391657 9:136336317-136336339 GCGGCAGAACTGAGGGTGGAAGG - Intronic
1062488190 9:136791463-136791485 GAAGCTGACCTGAGCGAGGCGGG + Intronic
1062493424 9:136820298-136820320 GAGGCTGCAGTGAGCTAGGATGG + Intronic
1062527374 9:136983421-136983443 GATGCAGAACTGAGGGAGGGGGG - Exonic
1185544846 X:935295-935317 AAGGTTGAACTGAGGGAGCTAGG + Intergenic
1185610891 X:1392981-1393003 GAGGCGGGAGGGAGGGAGGAGGG - Intergenic
1185612639 X:1401782-1401804 GAGGGTGAACTGAGGTCTGAGGG + Intergenic
1185612765 X:1402344-1402366 GAGGCTGCATTCGGGGAGGAGGG - Intergenic
1185612778 X:1402398-1402420 GAGGCTGAATTGGGGGAGGAGGG - Intergenic
1185612788 X:1402425-1402447 GAGGCTGCATTCAGGGAGGAGGG - Intergenic
1185612795 X:1402451-1402473 GAGGCTGAATTTTGGGAGGGGGG - Intergenic
1185612811 X:1402504-1402526 GAAGCTGTATTGGGGGAGGAAGG - Intergenic
1185612847 X:1402630-1402652 GAGGCTGCATTTGGGGAGGAGGG - Intergenic
1185612876 X:1402738-1402760 GAGGCTGCATTTGGGGAGGAGGG - Intergenic
1185612903 X:1402815-1402837 GAGGCTGCATTCGGGGAGGAGGG - Intergenic
1185612912 X:1402842-1402864 GAGGCTGCATTCGGGGAGGAGGG - Intergenic
1185612921 X:1402869-1402891 GAGGCTGCATTCGGGGAGGAGGG - Intergenic
1185612930 X:1402896-1402918 GAGGCTGCATTCGGGGAGGAGGG - Intergenic
1185612962 X:1403000-1403022 GAGGCTGCATTTGGGGAGGAGGG - Intergenic
1185889880 X:3814583-3814605 GAGGCTGAGCTGCGTGAGGGAGG - Intergenic
1185921668 X:4100001-4100023 GAGGATGAAGGGTGGGAGGAGGG - Intergenic
1185930552 X:4198386-4198408 GAGGGTGAAGGGTGGGAGGAGGG - Intergenic
1186157067 X:6736851-6736873 GAGGGTGGACAGTGGGAGGAGGG + Intergenic
1186207698 X:7217223-7217245 GAGGTTGAACAGATGGAGGGGGG + Intergenic
1186471023 X:9822311-9822333 GAGGCTGCAGTGGGGGAGGTGGG + Intronic
1186570592 X:10711133-10711155 GAGTCTGAAGTAAGGGAGGAAGG - Intronic
1186659193 X:11651280-11651302 GAGGGTGAGCAGTGGGAGGAGGG - Intronic
1186688623 X:11951591-11951613 GAGGGTGAGCAGTGGGAGGAGGG + Intergenic
1186749245 X:12604806-12604828 GAGGGTGAAGGGTGGGAGGAGGG - Intronic
1187035395 X:15533347-15533369 GAGGCTTACTTGAGGGTGGAGGG - Intronic
1187048066 X:15667781-15667803 GAGGCTGCACTGAGCTAAGATGG - Intergenic
1187053745 X:15720229-15720251 GAGGCTGCACTGAGCTATGATGG - Intronic
1187464735 X:19516748-19516770 GAGGGTGAAGGGTGGGAGGAAGG - Intergenic
1187556236 X:20354805-20354827 GTGGGTGAAGTGAGGAAGGAGGG + Intergenic
1187653672 X:21442997-21443019 GAGGGTGAAGGGTGGGAGGAGGG + Intronic
1187802009 X:23074425-23074447 GAGGGTAAACAGTGGGAGGAGGG + Intergenic
1188134449 X:26477324-26477346 GAGGGTGAAGGGTGGGAGGAGGG + Intergenic
1188259144 X:28001907-28001929 GAGGGTGGAGGGAGGGAGGAGGG - Intergenic
1188289430 X:28369497-28369519 GATGGTGGACTGTGGGAGGAGGG - Intergenic
1188327520 X:28823730-28823752 GAGCTTGGAGTGAGGGAGGAAGG - Intronic
1188394327 X:29661933-29661955 GAGGCAGAATGGAGGCAGGAAGG - Intronic
1188755986 X:33964333-33964355 GAGGGTGAAGAGTGGGAGGAGGG - Intergenic
1189161114 X:38809900-38809922 AATGCAGAACAGAGGGAGGAAGG - Intergenic
1189426862 X:40909677-40909699 GAGGCAGAAGAGAGGGAGGAGGG + Intergenic
1189465763 X:41276491-41276513 GAGGCAGGAGGGAGGGAGGAAGG + Intergenic
1189522342 X:41783077-41783099 GAGGCTGAAGTGAGCCAAGATGG + Intronic
1189659365 X:43279974-43279996 GAGGGTGAAGCGTGGGAGGAGGG - Intergenic
1189855515 X:45220692-45220714 GAGGGTGGAGTGTGGGAGGAGGG + Intergenic
1189898309 X:45679473-45679495 GAGGGTGGAATGTGGGAGGAGGG + Intergenic
1190095287 X:47474811-47474833 GAGGCTGCAGTGAGTGATGATGG + Intronic
1190812202 X:53895629-53895651 GAGGGTGGAAGGAGGGAGGAGGG + Intergenic
1190880651 X:54490182-54490204 GAGGGTGGAGGGAGGGAGGAGGG + Intronic
1191137505 X:57082079-57082101 GAGGGTGAAGGGTGGGAGGAGGG + Intergenic
1191630976 X:63321839-63321861 GAGGGTGGACGGCGGGAGGAGGG + Intergenic
1191700425 X:64036110-64036132 GAGGCTGGACGGTGGGAGGAGGG + Intergenic
1191824105 X:65345542-65345564 GAGGGTGGAGTGTGGGAGGAGGG + Intergenic
1191849018 X:65571896-65571918 GATTCTGAGCAGAGGGAGGAAGG + Intergenic
1191991052 X:67037410-67037432 GAGGGTGGAGTGTGGGAGGAGGG + Intergenic
1192227027 X:69236607-69236629 TTGGCAGAAGTGAGGGAGGAAGG - Intergenic
1192703246 X:73498409-73498431 GAGGGTGAGCTGAAGTAGGATGG - Intergenic
1192831844 X:74758551-74758573 GAGGGTGGAGGGAGGGAGGAGGG - Intronic
1192888989 X:75367896-75367918 GAGGGTGAAGGGTGGGAGGAGGG - Intergenic
1192973804 X:76261477-76261499 GAGGGTGAACTGAGGCAAGGCGG - Intergenic
1192977364 X:76300314-76300336 GAGGCTGAGCTGAAGCAGGGTGG - Intergenic
1193336033 X:80290558-80290580 GAGGGTGAAGGGTGGGAGGAGGG + Intergenic
1193369133 X:80672369-80672391 GAGGCCGAGGTGAGGAAGGAAGG + Exonic
1193408485 X:81133708-81133730 GAGGGTGAAGGGTGGGAGGAGGG + Intronic
1193448667 X:81639421-81639443 GAGGGTGAAGTGTGGGAGGAGGG - Intergenic
1193522005 X:82541807-82541829 GAGGGTGAAGGGTGGGAGGAGGG + Intergenic
1193552760 X:82918633-82918655 GATGGTGAACAGTGGGAGGAGGG - Intergenic
1193687748 X:84598937-84598959 GAGGCCTACATGAGGGAGGAGGG + Intergenic
1193696616 X:84714946-84714968 GAGGGTGAAGGGTGGGAGGAGGG - Intergenic
1195288811 X:103411745-103411767 GAGGCCTACCTGAGGGTGGAGGG - Intergenic
1195977373 X:110542269-110542291 GAGGATGGAGGGAGGGAGGATGG - Intergenic
1196016367 X:110944512-110944534 GAGCAGGAACTGGGGGAGGAAGG - Intronic
1196200678 X:112882551-112882573 GAGGGTGGACAGTGGGAGGAGGG + Intergenic
1196314011 X:114201819-114201841 GAGGCTGAAGGGAGGGAGTTAGG + Intergenic
1196540752 X:116904080-116904102 GAGGTTGAAAAGTGGGAGGAGGG + Intergenic
1196672655 X:118385503-118385525 GAGGGTGAAGGGTGGGAGGAGGG + Intronic
1197027271 X:121768577-121768599 GAGGCTGAAGGGAGGGAAGAGGG + Intergenic
1197651604 X:129071542-129071564 GAGGGGGAAAAGAGGGAGGAAGG + Intergenic
1197834185 X:130677203-130677225 GAGGAGGAAGTGAGGGAGGAAGG - Intronic
1198225213 X:134638938-134638960 GGGGCCTAACTGAGGGTGGAGGG - Intronic
1198560358 X:137843271-137843293 GAGGGTGGACTGGGGGAGGATGG - Intergenic
1198725866 X:139676295-139676317 GAGGGTGAACTGAAGCAGGGTGG - Intronic
1199706604 X:150431558-150431580 GAGGGTGGACGGAGGGAAGAGGG - Intronic
1199791376 X:151158439-151158461 GAGGGTGGAGGGAGGGAGGAGGG - Intergenic
1199964000 X:152803285-152803307 GAGGCTGGAGAGTGGGAGGAGGG - Intergenic
1200836356 Y:7735881-7735903 GAGGCTGAAGTGTGGCAGGAAGG + Intergenic