ID: 1181300116

View in Genome Browser
Species Human (GRCh38)
Location 22:21873906-21873928
Sequence GTGAATAATGCTGATGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181300116_1181300117 26 Left 1181300116 22:21873906-21873928 CCAGCAGCATCAGCATTATTCAC No data
Right 1181300117 22:21873955-21873977 GACCCAACCTGAATAAAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181300116 Original CRISPR GTGAATAATGCTGATGCTGC TGG (reversed) Intergenic
No off target data available for this crispr