ID: 1181313002

View in Genome Browser
Species Human (GRCh38)
Location 22:21955650-21955672
Sequence GTGCAGAAGCATAGTAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181313000_1181313002 -5 Left 1181313000 22:21955632-21955654 CCTGTGGCTGAAAGCGCAGTGCA No data
Right 1181313002 22:21955650-21955672 GTGCAGAAGCATAGTAAGGAAGG No data
1181312998_1181313002 0 Left 1181312998 22:21955627-21955649 CCCTGCCTGTGGCTGAAAGCGCA No data
Right 1181313002 22:21955650-21955672 GTGCAGAAGCATAGTAAGGAAGG No data
1181312999_1181313002 -1 Left 1181312999 22:21955628-21955650 CCTGCCTGTGGCTGAAAGCGCAG No data
Right 1181313002 22:21955650-21955672 GTGCAGAAGCATAGTAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181313002 Original CRISPR GTGCAGAAGCATAGTAAGGA AGG Intergenic
No off target data available for this crispr