ID: 1181313457

View in Genome Browser
Species Human (GRCh38)
Location 22:21957733-21957755
Sequence CAGGAGCCGAAACATGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 2, 1: 0, 2: 0, 3: 12, 4: 150}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181313457_1181313465 29 Left 1181313457 22:21957733-21957755 CCTTGCTCATGTTTCGGCTCCTG 0: 2
1: 0
2: 0
3: 12
4: 150
Right 1181313465 22:21957785-21957807 TGAAACCTCCTCAACTTTCAAGG 0: 2
1: 0
2: 1
3: 15
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181313457 Original CRISPR CAGGAGCCGAAACATGAGCA AGG (reversed) Intronic
900123198 1:1058355-1058377 CCAGACCCGAAGCATGAGCAGGG + Intergenic
900572924 1:3368266-3368288 CAGGAGCCGCAACACGGGCCAGG + Intronic
900677283 1:3895621-3895643 CAGGAGTCAAAACATGAGATCGG + Intronic
903801638 1:25973013-25973035 CAGGAGCAGGGACAGGAGCAAGG + Intronic
904241445 1:29148841-29148863 CAGGAGCCGCAGCAAGAGCAAGG - Exonic
906801327 1:48739758-48739780 CAGGAGCGGAAACATGGGGAGGG - Intronic
908261893 1:62345461-62345483 CAGGAGCTGAAGCATGAGAATGG + Intergenic
909418754 1:75438487-75438509 CAGGAGCTGAAACCTAAGTAGGG + Intronic
1062969186 10:1633062-1633084 CAGGAGAGGAAGCAGGAGCACGG - Intronic
1066468111 10:35670926-35670948 CAGGTGATTAAACATGAGCAAGG - Intergenic
1068848466 10:61707859-61707881 CAGAAGCTGATACATGAGCTTGG + Intronic
1070147076 10:73782231-73782253 CGGAAGCCGGAGCATGAGCAGGG + Intronic
1071384654 10:85107117-85107139 CAGGAGCCGAAAAATGATTTTGG - Intergenic
1071777572 10:88806341-88806363 CAGGAGGAGCAAAATGAGCAGGG - Intronic
1075476387 10:122738440-122738462 AAGGATCAGAGACATGAGCAAGG - Intergenic
1075624485 10:123951865-123951887 CAGGAGCAGGACCAAGAGCAAGG + Intergenic
1076623167 10:131806030-131806052 CAGGAGCTGACACATGAGCCAGG + Intergenic
1076869506 10:133186447-133186469 CAGGAGCCGGAACACCAGCTGGG + Exonic
1077114255 11:876140-876162 CAGGAGCCGGCACAGGTGCAAGG + Intronic
1077533068 11:3106327-3106349 CGGGAGGCGAGACAAGAGCAAGG - Intronic
1077579379 11:3407162-3407184 CAGGAGCCGGCTCCTGAGCAGGG - Intergenic
1083204136 11:61137858-61137880 CACAAGCAGAAACAGGAGCAGGG + Intronic
1084236412 11:67790705-67790727 CAGGAGCCGGCTCCTGAGCAGGG - Intergenic
1084836003 11:71802288-71802310 CAGGAGCCGGCTCCTGAGCAGGG + Intergenic
1086289191 11:85286839-85286861 CAGGAGACATAAGATGAGCATGG + Intronic
1088141344 11:106620681-106620703 CAAGAGCGAAAACATGCGCAGGG - Intergenic
1095826609 12:46536493-46536515 CAGGAGCAGGACCATGAGCATGG + Intergenic
1096374778 12:51099678-51099700 CAGCAGCAGAAGCATGAGGATGG - Exonic
1097053069 12:56235211-56235233 CAGGAGCCGCAGCAGCAGCAGGG - Exonic
1098393098 12:69990302-69990324 CAGGACCTGGAAAATGAGCAAGG - Intergenic
1104075821 12:125388761-125388783 CAGGAGCCAGAAGACGAGCAGGG - Intronic
1106185334 13:27404873-27404895 CAGGAGCTAAAACATGGGCAAGG + Intergenic
1106651994 13:31701071-31701093 CAGTAGGAGCAACATGAGCAAGG - Intergenic
1107669429 13:42728882-42728904 CAGGAACTGAAACATAAGCTTGG + Intergenic
1108085089 13:46779832-46779854 CTAGAGCCCTAACATGAGCAGGG + Intronic
1108106592 13:47017209-47017231 CAGGAGCTGAAGCAGTAGCAAGG + Intergenic
1112501576 13:99947159-99947181 CAGGAGCCGTGCCATGAGTAGGG - Intergenic
1115304669 14:31921979-31922001 CCGCAGCTGAAACATTAGCAGGG - Intergenic
1116532323 14:45988192-45988214 CAGGAGTCTAAACAGCAGCATGG - Intergenic
1118005926 14:61564121-61564143 CAGGAGGGGAATCATGAGCCAGG - Intronic
1118221751 14:63860879-63860901 CTGCAGTGGAAACATGAGCAGGG + Intronic
1118367651 14:65109376-65109398 CAGGAGCTGAAAGATGAGGTTGG - Intergenic
1121288127 14:92752450-92752472 CATGAGCAGAAACAGGAGCACGG - Intergenic
1121776211 14:96592764-96592786 CAGGAGCCGGAGCAGGAACAGGG - Intergenic
1121890830 14:97588913-97588935 CAGGAGCAGAGCCATGAGAAGGG - Intergenic
1124455665 15:29840553-29840575 CAGGAGCTGAATCTTGGGCATGG + Intronic
1129157938 15:73730549-73730571 AAGGAACCGAAAGGTGAGCAGGG + Intergenic
1130021142 15:80232878-80232900 CAGGAGCCAGAACCTGAGCCTGG - Intergenic
1130151685 15:81316072-81316094 CAGGAGCCGGAGCAAGAGCGGGG - Intronic
1130822226 15:87507803-87507825 TAGGAGCAGAAAGAAGAGCAGGG - Intergenic
1131537139 15:93246811-93246833 CAGAAGCAGAAAAATCAGCAAGG - Intergenic
1133720182 16:8487549-8487571 CAGGAGCAGACATATCAGCAAGG + Intergenic
1137373052 16:47926624-47926646 TAGTAGCAGAAACATGAGAAGGG + Intergenic
1141196576 16:81865625-81865647 CAGGAGCCCAGACAGCAGCAGGG - Intronic
1142038240 16:87875841-87875863 TAGGAGCCGAAACAGGAGGCTGG + Intergenic
1144371555 17:14596194-14596216 CAGGAGCAAAAACATGCACATGG - Intergenic
1144498438 17:15765091-15765113 CAGGAGCTGAAAAAGGAGAAAGG - Intergenic
1144797812 17:17904462-17904484 AAGGAGCTGAAAGATCAGCAGGG + Intronic
1145161820 17:20580132-20580154 CAGGAGCTGAAAAAGGAGAAAGG - Exonic
1152460669 17:80440623-80440645 CACCAGCAGCAACATGAGCATGG - Intergenic
1152478234 17:80532443-80532465 TAGAAGCAGAAACAGGAGCAGGG - Intergenic
1153137189 18:1930051-1930073 CAGGAGCCGCTACAAGAGCCAGG + Intergenic
1161058931 19:2204776-2204798 GAGGACCTCAAACATGAGCAGGG - Intronic
1163807914 19:19411198-19411220 CAGCCGCCGAATAATGAGCAAGG - Intronic
1168454454 19:56495547-56495569 CAGGAGCCAAAGTATGGGCAAGG + Intergenic
927656618 2:24953090-24953112 CAGAACATGAAACATGAGCAGGG - Intronic
928328916 2:30342262-30342284 CAGGACCCAAAAGATGAACAGGG + Intergenic
935404106 2:102690186-102690208 AAGGAGGCGAAACATCAGAAGGG + Intronic
935981060 2:108628105-108628127 CAAGGGCAGAAACAGGAGCAAGG - Intronic
941394791 2:164961210-164961232 CAGGAGGCAAAGCAGGAGCAAGG + Intergenic
941743543 2:169062263-169062285 TTGGAGCCGAAACAACAGCATGG + Intergenic
943928440 2:193819251-193819273 AAAGAGCTGTAACATGAGCAGGG - Intergenic
945770343 2:214034873-214034895 AAAGAGCTGTAACATGAGCAAGG - Intronic
947583086 2:231333781-231333803 CAGGCACGTAAACATGAGCAAGG + Intronic
948410096 2:237752629-237752651 CAGGTCCCCAAACATGAGGAGGG - Intronic
1170565165 20:17596353-17596375 CAGTGGCAGAAATATGAGCACGG - Intronic
1172563100 20:35906630-35906652 CAGCAGCTGAAAGATAAGCAAGG - Intronic
1173055212 20:39605247-39605269 CTGGGGCCTAAAGATGAGCAAGG + Intergenic
1174066751 20:47871427-47871449 CTTGAGCTGAAACATGAGTAGGG + Intergenic
1174360574 20:50026664-50026686 CTGCACCCGAAACAAGAGCATGG - Intergenic
1174449517 20:50610701-50610723 CAGGAGGCTAAGGATGAGCAGGG - Intronic
1175585022 20:60132347-60132369 CAGGAGCCCAGATATGATCACGG - Intergenic
1175871820 20:62212867-62212889 CAGGAGCCGGAAGGAGAGCAGGG + Intergenic
1176349679 21:5782569-5782591 CAGGACCCATAACATGGGCAGGG + Intergenic
1176356493 21:5903153-5903175 CAGGACCCATAACATGGGCAGGG + Intergenic
1176544000 21:8180639-8180661 CAGGACCCATAACATGGGCAGGG + Intergenic
1176562951 21:8363684-8363706 CAGGACCCATAACATGGGCAGGG + Intergenic
1178086973 21:29122038-29122060 CAGGTGCACAAACATGAACATGG - Intronic
1179552271 21:42150826-42150848 CAGGAGCCGAAACCTTCCCAAGG - Intergenic
1179880193 21:44290399-44290421 CTGGGGACGAAAGATGAGCATGG - Intronic
1181313457 22:21957733-21957755 CAGGAGCCGAAACATGAGCAAGG - Intronic
1181346563 22:22223805-22223827 CAGGAGCCGAAACATGAGCAAGG - Intergenic
1181911739 22:26243857-26243879 CAAGAGAAGAAAGATGAGCAGGG + Intronic
1182442144 22:30370851-30370873 CAGGCGCTGAAACAGGAGCAGGG + Exonic
1183739911 22:39663708-39663730 CAGGACCCGGAACCTGGGCAGGG - Exonic
1184455409 22:44607219-44607241 GAGGAGGCGAGACCTGAGCAGGG + Intergenic
1185001847 22:48251019-48251041 CAGGAGCCTAAGCAGGGGCAGGG - Intergenic
1203248869 22_KI270733v1_random:96862-96884 CAGGACCCATAACATGGGCAGGG + Intergenic
951180410 3:19652875-19652897 CAGCAGCCTAAGCATGAGCTTGG + Intergenic
954133470 3:48571420-48571442 CAGGAGCTCAGACATGACCATGG + Intronic
956392162 3:68785395-68785417 CAGGAGCCCACAGAGGAGCAGGG + Intronic
956428224 3:69158544-69158566 CTGAAGCTGAAACATTAGCAAGG - Intergenic
956474093 3:69600872-69600894 GAGGAGCTGATACATGAGCTGGG + Intergenic
960596724 3:119414138-119414160 GAGAAGCCGGAACCTGAGCAGGG + Exonic
961676141 3:128568037-128568059 CAGGAGCTTAAACATAGGCAGGG - Intergenic
963117020 3:141738672-141738694 CAGGAGCCGCAGCAGGAGCGTGG - Intronic
964546831 3:157843566-157843588 CAGCAGCAGCAAAATGAGCAAGG + Intergenic
965424079 3:168499537-168499559 GAGGTACCGAAACATGACCAAGG - Intergenic
965777925 3:172253228-172253250 AAGGAGCCGAAAGATGATAAGGG + Intronic
968604872 4:1530404-1530426 CAGGAACCTACACCTGAGCAGGG - Intergenic
968995166 4:3940860-3940882 CAGGAGCCGGCTCCTGAGCAGGG - Intergenic
969758821 4:9167932-9167954 CAGGAGCCGGCTCCTGAGCAGGG + Intergenic
970600806 4:17639616-17639638 CAGAAGGAGAAACCTGAGCATGG + Intronic
973981776 4:56314037-56314059 TAGGATCCACAACATGAGCAAGG + Exonic
976974944 4:91154484-91154506 CAGGAGCAGGAGCAGGAGCAGGG - Intronic
977036920 4:91965627-91965649 CAGGAGCAGAAGAATGATCATGG - Intergenic
978280625 4:107008054-107008076 CAGCAGCTGAAACATAAGCTGGG - Intronic
980158459 4:129133473-129133495 CAGGAGCTGAAAAAGGAGAAAGG - Intergenic
980503117 4:133682465-133682487 CTGGAGCTGAGGCATGAGCAAGG - Intergenic
984957831 4:185063355-185063377 CTGGAGCCGCCACATCAGCATGG + Intergenic
985694108 5:1330340-1330362 CAGGAACAGAAAGATGACCACGG + Exonic
985967704 5:3350263-3350285 CAGCAGTCCAAACATGTGCAAGG - Intergenic
991937733 5:71818403-71818425 AGGGACCCAAAACATGAGCAGGG - Intergenic
993236403 5:85315802-85315824 CAGTAGCCAAAACAGCAGCAGGG - Intergenic
999870673 5:155747054-155747076 CAGGTGGCCAGACATGAGCAGGG - Intergenic
1003989279 6:11469859-11469881 AAGGAGCAAAAACATGAGCATGG + Intergenic
1004194158 6:13488519-13488541 CAGGAGCCGAAGCAAGAGGCGGG - Intergenic
1005210255 6:23452480-23452502 CAGGAGACGAAGGTTGAGCATGG - Intergenic
1005604614 6:27463528-27463550 CAGGAGGCGAAAGATGAGAGGGG + Intronic
1006345633 6:33479640-33479662 CAGGAGATGGAACATGTGCATGG + Intergenic
1006384242 6:33720395-33720417 CATGAGCCGGGAGATGAGCAAGG + Intergenic
1007335820 6:41154256-41154278 CAGGAGCAGCAGCAAGAGCAGGG + Exonic
1007582331 6:42966870-42966892 CAGGAAAGGACACATGAGCAGGG + Intronic
1008510926 6:52274844-52274866 CAGGACCTGAAACGTGAACATGG - Intronic
1008870591 6:56268188-56268210 CATGGGCCGACACAGGAGCAGGG + Intronic
1010189561 6:73180859-73180881 CAGCAGCCAAACCATGTGCAAGG - Intronic
1011398734 6:86937458-86937480 CAGGAGCAGGAGCATGGGCAGGG - Exonic
1015120114 6:129692085-129692107 CAGGAACAGAAAAATGGGCAGGG - Intronic
1017163070 6:151383561-151383583 CAGGAGCCAAATCATCACCAGGG - Intronic
1018003856 6:159602568-159602590 AAGGAGACTAAACAAGAGCAGGG + Intergenic
1018301727 6:162410156-162410178 CAGGAGCAGAAAAAACAGCAGGG - Intronic
1020521369 7:9191708-9191730 CACAGGCCCAAACATGAGCAAGG - Intergenic
1022089443 7:27098001-27098023 CAGGAGCCGAAACTGGGGCAGGG - Intergenic
1022712728 7:32866709-32866731 CAGAAACTGGAACATGAGCATGG - Intergenic
1024929044 7:54650565-54650587 CAGGAGCAGAAAGAGGAGAAAGG - Intergenic
1030107627 7:106000049-106000071 CAGGAGCCAAAACCAGAGCCAGG - Intronic
1030953479 7:115821503-115821525 CAAGAAAAGAAACATGAGCAAGG + Intergenic
1033414848 7:141152616-141152638 CAGGAGCAAGAACATTAGCAGGG + Intronic
1034867770 7:154656456-154656478 CAGCAGCCGCAGCATGTGCAGGG + Intronic
1035780853 8:2227435-2227457 CAGGGGCCGAGTCATGAGCAAGG - Intergenic
1038271391 8:26078764-26078786 CAGGAGGCGAAACAGGAGGATGG + Intergenic
1038313279 8:26462252-26462274 GAGGAGCTCAAAAATGAGCAAGG + Intronic
1039788938 8:40858786-40858808 CAGGGGCAGGAAGATGAGCACGG - Intronic
1047182951 8:122606419-122606441 CAGGAGCCTAATCATGATCCCGG - Intergenic
1048850934 8:138644725-138644747 CAGAAGGAGAAACATGTGCATGG - Intronic
1050545009 9:6702290-6702312 CAGGAGCAGAAACAGAAGTAGGG + Intergenic
1059367005 9:113794200-113794222 CAGGACCCGGAACATGGGTATGG + Intergenic
1059823172 9:117996699-117996721 GTGGAGCCGAAACAGCAGCATGG + Intergenic
1061584955 9:131559567-131559589 CAGGGGCTGAAACAGGAGAATGG + Intergenic
1203465269 Un_GL000220v1:80110-80132 CAGGACCCATAACATGGGCAGGG + Intergenic
1189046921 X:37603199-37603221 CAGGATCTAAAAGATGAGCAGGG + Intronic
1192273678 X:69608796-69608818 CAGGAGGCGGAACTTGAGCTGGG + Intergenic
1193874524 X:86845530-86845552 CAGTAGCTTAAACATGGGCAAGG - Intergenic
1197988581 X:132293462-132293484 CAGGAGCAGAAACTTGTTCAAGG + Intergenic