ID: 1181313982

View in Genome Browser
Species Human (GRCh38)
Location 22:21960278-21960300
Sequence AGGGAGCCTCGGTGGGCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 5, 3: 34, 4: 239}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181313970_1181313982 20 Left 1181313970 22:21960235-21960257 CCTGTCTGGAGCGGGCAGCAGAG 0: 1
1: 1
2: 1
3: 17
4: 227
Right 1181313982 22:21960278-21960300 AGGGAGCCTCGGTGGGCCCTGGG 0: 1
1: 0
2: 5
3: 34
4: 239
1181313976_1181313982 -10 Left 1181313976 22:21960265-21960287 CCAGGGAGAAGCCAGGGAGCCTC 0: 1
1: 1
2: 4
3: 55
4: 490
Right 1181313982 22:21960278-21960300 AGGGAGCCTCGGTGGGCCCTGGG 0: 1
1: 0
2: 5
3: 34
4: 239
1181313973_1181313982 -3 Left 1181313973 22:21960258-21960280 CCAACATCCAGGGAGAAGCCAGG 0: 1
1: 1
2: 1
3: 53
4: 352
Right 1181313982 22:21960278-21960300 AGGGAGCCTCGGTGGGCCCTGGG 0: 1
1: 0
2: 5
3: 34
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181313982 Original CRISPR AGGGAGCCTCGGTGGGCCCT GGG Intronic
900367112 1:2315793-2315815 AGGGAGCCTGGCTGCGCCCCAGG + Intergenic
900387418 1:2416917-2416939 AGCCAGCCTGGGGGGGCCCTGGG + Intergenic
900467661 1:2833657-2833679 GGGGAGCCTCGGTGCTGCCTGGG - Intergenic
900571917 1:3362815-3362837 AGGGAGCGTCGGGGAGCCATAGG + Intronic
900982989 1:6057185-6057207 AGGGAGCCTCTGCGGTCCTTGGG + Intronic
901638044 1:10679529-10679551 AGGGGCCCGCGGGGGGCCCTAGG - Intronic
901642242 1:10698671-10698693 AGGGACCCTCCTTGGCCCCTTGG - Intronic
901654117 1:10759625-10759647 CGGGAGCCTTGGTGCGCACTGGG - Intronic
901668298 1:10838763-10838785 AGGGGGCCTGGCTGGGCCCTGGG + Intergenic
902371069 1:16007076-16007098 AGGCAGCCCAGGTGGGACCTGGG + Exonic
903885666 1:26539774-26539796 ATGGAGCCCCGGTGTGCCTTAGG - Intronic
904399739 1:30248238-30248260 AGGTAGCCCTGGTGGGCCCAGGG + Intergenic
906609672 1:47192667-47192689 AGGGAGCATGGGTGGACACTTGG + Intergenic
906925912 1:50116457-50116479 TGGGAGCCCCGGTGTGCCGTGGG + Intronic
912384276 1:109263556-109263578 GTGGAGCCTCAGAGGGCCCTGGG - Intronic
912568682 1:110606676-110606698 ACTGAGCCTCGGCGGTCCCTCGG - Intronic
912638486 1:111320978-111321000 AGGGAGCCTGGCTGGCCCATGGG - Intergenic
912975256 1:114323894-114323916 ATGGGCCCTCAGTGGGCCCTGGG + Intergenic
913030925 1:114902058-114902080 AGCCAGCCTCGTGGGGCCCTTGG + Intronic
915409255 1:155688144-155688166 AGGGATCCGCGGTGGACCCAGGG - Exonic
922575664 1:226659324-226659346 AGGGAGCCTTGGTGAGGCCCTGG - Intronic
923402618 1:233629573-233629595 GGGGAGCCTCTGTGGGCTCCTGG + Intronic
924707197 1:246510545-246510567 AGGGTCTCTCGGTGGCCCCTGGG + Intergenic
1067077881 10:43198346-43198368 AGGGTGCCTGGCTGAGCCCTGGG + Intronic
1067161182 10:43826153-43826175 CGGGAGCCTCGGGAGGGCCTCGG - Intergenic
1067215135 10:44294937-44294959 AGGATGCCTCTGTGGGGCCTGGG + Intergenic
1067338016 10:45379869-45379891 TAGAAGGCTCGGTGGGCCCTGGG - Intronic
1068783727 10:60946787-60946809 TGTGAGCCTTGGTGTGCCCTGGG - Intronic
1069878937 10:71579847-71579869 AGGGAACACCGGTGAGCCCTGGG + Intronic
1069992193 10:72322693-72322715 AGGCAGCCTCAGTGGGCCCCGGG + Intergenic
1071211600 10:83348194-83348216 AGGGAGCCTCTTTGGGCCCTGGG + Intergenic
1072757598 10:98030961-98030983 AGGGCGCCTGGCTGGGCGCTGGG + Intergenic
1075402583 10:122171824-122171846 AATGAGCCTCCTTGGGCCCTTGG + Intronic
1075746771 10:124733457-124733479 AGGGAGCTTCGGTGCCCCCTGGG - Intronic
1075948914 10:126460706-126460728 AGGGGGCCTCGGTGGGACCTGGG - Intronic
1076504714 10:130964071-130964093 AGGGAGCCTCACTGGGCCATGGG + Intergenic
1076550300 10:131273600-131273622 AGGGAGCCTCGGTCAGCCCAGGG - Intronic
1076605809 10:131689237-131689259 TGGGAGCCTCTGTGGGCTCCTGG - Intergenic
1077047423 11:552619-552641 AGGGACCCTCCGTGGGCCCCAGG - Exonic
1077059421 11:611291-611313 AGGGTGCCTCAGTGCACCCTGGG + Intronic
1077082091 11:728732-728754 AAGGGGCCTCTGTGGGCCCCAGG + Intergenic
1077272782 11:1689657-1689679 AGGCAGCATGGGTGGGCGCTGGG - Intergenic
1077311344 11:1890269-1890291 GGGGAGCCTCGGCGGGGCGTGGG + Exonic
1077487287 11:2844938-2844960 AGGGAGCTGAGGTGAGCCCTAGG + Intronic
1077577907 11:3398370-3398392 CAGGAGCCACAGTGGGCCCTGGG + Intergenic
1077819688 11:5724864-5724886 AGGGAGCCTCTGTGTTCCCTAGG - Intronic
1078108637 11:8374208-8374230 AGTGAGCCCCTGTGGACCCTGGG - Intergenic
1082076636 11:47980531-47980553 AGGGAGCCGCGGCGAGCGCTCGG - Intergenic
1083505947 11:63157362-63157384 AGGGAGCATCTCTGGGCACTGGG - Intronic
1083743690 11:64723688-64723710 AGGGGGACTCGGTGGGTCCATGG + Intergenic
1083880123 11:65544233-65544255 AGGCAGCCTCTGAGGGCCCCAGG - Intronic
1084173035 11:67409707-67409729 GTGGAGCCTCGTTGGGGCCTGGG - Exonic
1084231852 11:67759271-67759293 CAGGAGCCACAGTGGGCCCTGGG + Intergenic
1084553688 11:69863827-69863849 AGGAAGCCTCAGGGGGCTCTTGG - Intergenic
1085299579 11:75450333-75450355 AGGGAGGCTGGGCGGGACCTTGG - Intronic
1085508011 11:77071140-77071162 AGCCAGCCTCGGTGGGCACTGGG - Intronic
1085702517 11:78757529-78757551 AGGGGGCCTCAGTGGGAGCTGGG + Intronic
1088903560 11:114137064-114137086 AGAGAGCCTGGGAGGTCCCTGGG - Intronic
1090819650 11:130330010-130330032 AGGGAGACTCTCTGTGCCCTTGG + Intergenic
1092741969 12:11638867-11638889 TGGGAGACTGTGTGGGCCCTTGG - Intergenic
1094486014 12:30926623-30926645 AGGAAGCCTCAGTGGGCGCAGGG + Intronic
1094711719 12:32970636-32970658 AGGGAGCCTCGATGGCCCCTGGG + Intergenic
1096157357 12:49347925-49347947 AGGGGGCCGGGGAGGGCCCTGGG + Exonic
1096617130 12:52839738-52839760 AGGGAGGCTTGGAGGGACCTGGG - Intronic
1096718587 12:53505346-53505368 AGTGAGCCTCTCTGGGCCCTAGG + Intronic
1105330607 13:19412162-19412184 GGGGAGCCTCAGTCTGCCCTTGG - Intergenic
1105918678 13:24940937-24940959 GGGGAGCCTCAGTCTGCCCTTGG - Intergenic
1108081576 13:46742451-46742473 AGGGAGCCGCGAAGGGCGCTGGG + Exonic
1108648118 13:52450439-52450461 AGGGACCCCCGGTGGGCGCGCGG - Intronic
1112599555 13:100841430-100841452 AGACAGCATGGGTGGGCCCTGGG + Intergenic
1113460801 13:110480468-110480490 TGGGCGCCTCTGTGGGCCGTGGG + Intronic
1113614868 13:111673127-111673149 AGGGAGGCTGCGTGGGCCCCAGG + Intergenic
1113620337 13:111758041-111758063 AGGGAGCCTGCGTGGGCCCCAGG + Intergenic
1113808935 13:113125964-113125986 AGGGTGTCTCGGAGGGCGCTGGG + Intronic
1118601282 14:67472827-67472849 AGGGAGCAGCGCAGGGCCCTGGG + Exonic
1119441450 14:74631341-74631363 AGGGTGCCTCTGTAGCCCCTTGG - Intergenic
1119620908 14:76131297-76131319 AGGGAGCCTCGCTTGCCCGTCGG + Intergenic
1122137713 14:99644577-99644599 GGGGAGCCCCAGTGGGTCCTGGG + Intergenic
1122862437 14:104588589-104588611 AGGGAGCCGCCGTGTGGCCTGGG - Intronic
1123008857 14:105337696-105337718 AGGGGGCTCAGGTGGGCCCTGGG - Intronic
1123054436 14:105562363-105562385 TGGGAGCCTGGGGGAGCCCTGGG + Intergenic
1123079020 14:105682782-105682804 TGGGAGCCTGGGGGAGCCCTGGG + Intergenic
1123194853 14:106606433-106606455 AGAGAACCACGGTGAGCCCTGGG + Intergenic
1124222232 15:27860972-27860994 AGGGAGCCTCTGTGGACCACAGG + Intronic
1127918745 15:63476621-63476643 AGGCAGCCTGGGTGGTCACTCGG + Intergenic
1131063509 15:89418591-89418613 AGGGAGGCTAGGTGGGCACAGGG + Intergenic
1132087664 15:98921502-98921524 AGGAAGCCTGGGTGGGCTCCAGG + Intronic
1132539155 16:500202-500224 AGGCAGGCTCCCTGGGCCCTGGG + Intronic
1132649411 16:1013814-1013836 AGGGGGCCTGGGCGGGGCCTGGG + Intergenic
1132759680 16:1502574-1502596 TGTGAGCCTCGGTGAGGCCTCGG + Intronic
1132854072 16:2037045-2037067 AGGGGGCCTCTGTCGGGCCTGGG - Intronic
1133528311 16:6628061-6628083 AGGGAGCCTGGCTGGGCTCATGG - Intronic
1133761087 16:8798637-8798659 TGAGAGCCTCTTTGGGCCCTTGG + Intronic
1133767170 16:8846149-8846171 AGGGAACGTCGCTGGGCCCAGGG - Intronic
1135407392 16:22207731-22207753 AGGGAGCTTCTGTGGGCCTGGGG - Intronic
1136066262 16:27761011-27761033 AGACAGCCTGGGTGGGGCCTAGG + Intronic
1136290234 16:29267333-29267355 AGGGACCCTCAGTGTGCCCCAGG + Intergenic
1136483062 16:30554992-30555014 AGGGGGCCTTGGAGAGCCCTGGG + Exonic
1137501392 16:49014180-49014202 AGGGAGCCAGGGTAGGTCCTGGG - Intergenic
1138244833 16:55459842-55459864 AGGGAAGCTGGGTGGGGCCTGGG - Intronic
1138577282 16:57916060-57916082 GGGGTGCCTCAGAGGGCCCTGGG - Intronic
1139652844 16:68371293-68371315 AGGGAGCCTGGGCAGCCCCTCGG - Exonic
1141102653 16:81209311-81209333 AGGGTGGCTCTGTGGGCCCAGGG - Intergenic
1142182197 16:88676733-88676755 CGGGAGGCTCAGTGGGCTCTGGG + Intergenic
1142472157 17:170508-170530 TGGGAGGCTGGGTGGGGCCTGGG + Intronic
1143377016 17:6472875-6472897 AGGGAGCCTCCTAGGGCCCAGGG - Intronic
1143634562 17:8156906-8156928 AGGGAGCCTCGGTGGGACCCAGG - Intronic
1143762087 17:9112171-9112193 AGGGAGCCCCAGTGGGGCCAAGG + Intronic
1144625693 17:16843426-16843448 AGGGAGCCTCTGCGGGCCCCTGG + Intergenic
1144872646 17:18380535-18380557 AGCCAGCCTGGCTGGGCCCTGGG - Intronic
1144880738 17:18429294-18429316 AGGGAGCCTCTGCGGGCCCCTGG - Intergenic
1145151497 17:20515093-20515115 AGGGAGCCTCTGCGGGCCCCTGG + Intergenic
1146162847 17:30569343-30569365 AGGGAGCCTCTGCGGGCCCCTGG + Intergenic
1146703423 17:34981214-34981236 AGGGAGGCTCGGGAGGCGCTGGG - Intronic
1146724532 17:35146981-35147003 AGGGAGCCTCAGTGTGTCCCAGG + Intergenic
1147579850 17:41622114-41622136 AGGGAGCCTCTGCAGGCCCCTGG + Intronic
1151667480 17:75553554-75553576 AGGCAGCCTCCTTAGGCCCTGGG - Intronic
1151748610 17:76024487-76024509 AGCCAGCCTGGCTGGGCCCTGGG + Intronic
1151942152 17:77299688-77299710 AGGGAGGCTCTGTGGGTCCTTGG + Intronic
1152078675 17:78173340-78173362 AGGGAGGCTGGGGAGGCCCTGGG + Exonic
1152333596 17:79687094-79687116 AGGGACCCTCGGTGGTCCCCAGG - Intergenic
1152365072 17:79850839-79850861 TGGGAGCCTCTATGGGCCTTGGG + Intergenic
1152506461 17:80752293-80752315 AGGGAGGCCCCATGGGCCCTGGG - Intronic
1152607976 17:81302558-81302580 GGGGAGCCTCAGGGGGGCCTGGG + Intergenic
1152623842 17:81379479-81379501 AGGGAGCCACAGTGAGCCCTGGG + Intergenic
1152687250 17:81700705-81700727 CGGGAGGCTCTGTGGGGCCTGGG - Exonic
1152748683 17:82052587-82052609 AGGGAGCCCCGGTGGGCCCGGGG + Intronic
1152796786 17:82311638-82311660 AGGAAGCCTGGGTGTGCCCTGGG + Intergenic
1155300841 18:24427181-24427203 AGTGAGATTCGGTGGGCTCTCGG - Intronic
1156489047 18:37485649-37485671 AGGGCGCGTCGGCGGGCCCGGGG - Intronic
1160142272 18:76336228-76336250 TGGGAGCCTCTGTGTTCCCTTGG - Intergenic
1160820359 19:1054946-1054968 AGGGAGCCTCAGGGGGCACCTGG + Intronic
1160932083 19:1575602-1575624 GTGGAGCCTCGGTGCGCCCAGGG + Intronic
1161028680 19:2048163-2048185 AGGAAGCCGCCTTGGGCCCTGGG + Intronic
1162015618 19:7845084-7845106 AGAGGGCCTCGCTGGGTCCTTGG - Intronic
1162042478 19:7979123-7979145 AGGGAGCCTCGGGGAGACCTGGG + Intronic
1162072005 19:8158574-8158596 AGGGAGCCACGGTGGGTTCTAGG + Intronic
1162402190 19:10453133-10453155 GGGGAGCCGCGGAGGGGCCTGGG - Intronic
1162967857 19:14164479-14164501 AGGGACCCTCAGTCGGGCCTGGG - Intronic
1163251442 19:16128473-16128495 AGGGAGCCCTGATGGGACCTGGG + Intronic
1165418598 19:35711047-35711069 AGGGAGCATCAGTGGGCTTTCGG - Intronic
1165760560 19:38319034-38319056 AGGGAGCCCTAGAGGGCCCTGGG - Intergenic
1166077273 19:40421061-40421083 GGGGAGCCTGGGTCGGCCCCAGG - Intergenic
1166230969 19:41425715-41425737 AGGAAGCCTGGGTGGGCCTGGGG + Exonic
1166781650 19:45346377-45346399 TGGGAGCCTCTGAGGGCACTGGG + Intronic
1166868168 19:45853746-45853768 AGGGAGCCCAGGGGGGCTCTGGG - Intronic
1167244571 19:48365465-48365487 AGGGGGCTTCTGTGGGCCCCAGG - Intronic
1167383072 19:49149674-49149696 AGGGAGCCCCGGAGAGCCCAGGG - Exonic
925561612 2:5202295-5202317 AAGTAGCCTCGGTGGGTACTGGG + Intergenic
926631897 2:15144145-15144167 AGGGACCGTGGGTGGGCCCTGGG - Intergenic
927312451 2:21646692-21646714 GGGGAGCCTCTGTGTGGCCTGGG - Intergenic
927856563 2:26531170-26531192 AGGCAGCCTCTGTGAGCTCTGGG + Intronic
928374470 2:30763711-30763733 AGTGAGCATCAGAGGGCCCTGGG + Intronic
930170804 2:48249746-48249768 AGGGAGCTTTGGTGTGGCCTTGG - Intergenic
930751701 2:54940754-54940776 AGGGTGCCCCAGTTGGCCCTGGG + Intronic
931428954 2:62195212-62195234 AGGGCGCATCGGTGGGCCCGGGG + Intergenic
931712386 2:64999707-64999729 TGGGAGCCTCAGTTGGCTCTTGG + Intronic
933678485 2:85078341-85078363 AGGGAAGCTGGGTGGGGCCTAGG - Intergenic
935765137 2:106359294-106359316 AGGGATCCTTGAGGGGCCCTCGG + Intergenic
937090186 2:119201081-119201103 ATGGAGCCTGGGTGGGCTCAGGG + Intergenic
937264567 2:120607790-120607812 AGGGGCCCTGGGTGGGACCTCGG - Intergenic
937289988 2:120776348-120776370 AGGGAGGCCCAGTGGGCTCTGGG + Intronic
937982274 2:127622710-127622732 AGGGAGCCCCTGTGGGCTCGGGG - Intronic
938822863 2:134976413-134976435 AGGGAGGCTCTCTGGGCTCTCGG + Intronic
940792037 2:158039168-158039190 AGGGGGCCTGGGTGTACCCTAGG + Intronic
947584322 2:231343260-231343282 AGTGAGCCTCACTGGACCCTGGG - Intronic
948226191 2:236311077-236311099 AGGGAGCCTTGGGGGTCCCTTGG + Intergenic
948515966 2:238504182-238504204 AGGGAGTCCAGCTGGGCCCTGGG + Intergenic
948826177 2:240574368-240574390 GGGCAGCCACGGGGGGCCCTGGG + Intronic
949009576 2:241670876-241670898 AGGCAGCCTCACTGGGCCGTGGG + Intronic
1169867533 20:10217788-10217810 AGGCTGCCTCGGGGGGCCCTCGG - Intergenic
1171389342 20:24791117-24791139 AGGGAGCCACGTTGGCCTCTGGG - Intergenic
1171848937 20:30294550-30294572 GGGGAGCCTCTGTTAGCCCTTGG + Intergenic
1172232805 20:33348356-33348378 TGGGAGTCTGGGTGAGCCCTGGG - Intergenic
1173320532 20:41983458-41983480 ATGGACCCTCCCTGGGCCCTGGG - Intergenic
1173656656 20:44704377-44704399 GGGGCTCCTCGGTGGGGCCTTGG + Intergenic
1175890476 20:62313721-62313743 AGGGTGACACGGTGGCCCCTGGG - Exonic
1175986247 20:62765462-62765484 AGGGAGCCTCCGGCCGCCCTGGG + Intergenic
1176375666 21:6085871-6085893 AGGAAGCCTCGCTGGGGCCACGG + Intergenic
1176742404 21:10616464-10616486 GGGGAGCCTCAGTCTGCCCTTGG + Intergenic
1178303591 21:31472068-31472090 GGGGAGCCTCGGTGGACACTTGG + Intronic
1178561522 21:33642955-33642977 CGGGGGCCGCGGTGGGCCGTGGG + Intronic
1179747808 21:43452373-43452395 AGGAAGCCTCGCTGGGGCCACGG - Intergenic
1179920036 21:44503012-44503034 AGCCGGCCTCGGTGAGCCCTCGG + Intronic
1179920118 21:44503271-44503293 AGCTGGCCTCGGTGAGCCCTCGG + Intronic
1179920148 21:44503363-44503385 AGCCGGCCTCGGTGAGCCCTCGG + Intronic
1179920176 21:44503455-44503477 AGCCGGCCTCGGTGAGCCCTCGG + Intronic
1179920253 21:44503697-44503719 AGCCGGCCTCGGTGAGCCCTCGG + Intronic
1179920281 21:44503789-44503811 AGCTGGCCTCGGTGAGCCCTCGG + Intronic
1179920321 21:44503910-44503932 AGCTGGCCTCGGTGAGCCCTCGG + Intronic
1179920358 21:44504049-44504071 AGTTGGCCTCGGTGAGCCCTTGG + Intronic
1179920403 21:44504218-44504240 AGCCGGCCTCGGTGAGCCCTCGG + Intronic
1179920442 21:44504338-44504360 AGCTGGCCTCGGTGAGCCCTCGG + Intronic
1179920453 21:44504383-44504405 AGCTGGCCTCGGTGAGCCCTCGG + Intronic
1179957480 21:44749611-44749633 TGGAGGCCTCGGTGGGCCCAAGG - Intergenic
1180099579 21:45578276-45578298 AGGGAGCCTGGGAGGGGCCTGGG + Intergenic
1180133382 21:45843114-45843136 AGGGGGACTGGCTGGGCCCTTGG - Intronic
1180564283 22:16649674-16649696 GGGGAGCCTCAGTCTGCCCTTGG + Intergenic
1180962172 22:19766970-19766992 GGAGAGCCGCGGTGGCCCCTGGG - Exonic
1181313982 22:21960278-21960300 AGGGAGCCTCGGTGGGCCCTGGG + Intronic
1181550613 22:23637134-23637156 AGGGACCCTCGGTGCATCCTAGG - Intergenic
1182351487 22:29702480-29702502 AGGGGCCCTCCTTGGGCCCTGGG + Intergenic
1182353634 22:29712435-29712457 AGGGAGACACTGTGGGTCCTGGG + Intergenic
1184096192 22:42317745-42317767 AGGGAGCCGAGGTGGGCACAGGG + Intronic
1184152072 22:42645071-42645093 AGTGAGCCTGGGTGGGCGCTGGG + Intronic
1184234177 22:43174274-43174296 GGGCAGCCAGGGTGGGCCCTCGG + Exonic
1185208059 22:49551541-49551563 AGGGAGGCTCCCTGGGGCCTGGG - Intronic
949935504 3:9112641-9112663 AGGGAGCATCAGGGGACCCTGGG + Intronic
950142025 3:10622117-10622139 GGGGAGCCTAGGGGGGCCCCTGG - Intronic
951906989 3:27715500-27715522 AGGGAGCCTAGGTGGGCCTAAGG + Intergenic
952139943 3:30466931-30466953 AGGGAGCCTCTCTGGGCACTGGG - Intergenic
954035723 3:47849950-47849972 AAGGAGCTGCGGCGGGCCCTGGG + Exonic
954692242 3:52401803-52401825 TGGGGGCCTGGGTGGGCCCTGGG - Exonic
954821895 3:53336925-53336947 AGTGAGCCTAGATGGCCCCTTGG - Intronic
957153287 3:76514306-76514328 TGAGCGCCTGGGTGGGCCCTAGG - Intronic
963661955 3:148137799-148137821 AGGGAGCCTTGGTGGGAGATTGG + Intergenic
964468558 3:157026215-157026237 GGGGAGACTCGGTGGAGCCTGGG - Intronic
968606806 4:1539390-1539412 TGGGAGCCAAGGTGGGGCCTGGG - Intergenic
968650564 4:1758744-1758766 AGGGAGACTCAGTGTGACCTCGG + Intergenic
968903272 4:3440830-3440852 ATGGAGGCGTGGTGGGCCCTGGG - Intergenic
968992958 4:3927031-3927053 CAGGAGCCACAGTGGGCCCTGGG + Intergenic
969286586 4:6206254-6206276 AGGGAGCCACTGGGGGCTCTTGG + Intergenic
969630708 4:8334270-8334292 AGGGAGTCTGGGGGGTCCCTGGG + Intergenic
969822517 4:9731330-9731352 CAGGAGCCACAGTGGGCCCTGGG - Intergenic
980960688 4:139471356-139471378 AGAGAGCCTCTCTGGGCACTGGG - Intronic
981624098 4:146736871-146736893 AGGGAGCCTCTGGGCTCCCTGGG + Intronic
983928209 4:173425619-173425641 AGAGAGTCTCATTGGGCCCTGGG - Intergenic
985553290 5:543886-543908 ACGGAGCCTCGGCGTGACCTCGG - Intergenic
998154387 5:139776176-139776198 AGGGAGCCTGGCTGAGCCCCTGG + Intergenic
1001084272 5:168689143-168689165 AGGGAGTCTGGGTGGGGCCTGGG + Intronic
1001645511 5:173278813-173278835 AGGGGGCCTGGGTGGACGCTGGG + Intergenic
1002401833 5:178995238-178995260 CGGGAGCCTGGGTGTGCGCTGGG - Intronic
1002926217 6:1607069-1607091 AGCACCCCTCGGTGGGCCCTGGG + Intergenic
1004016384 6:11735820-11735842 AGGGAGCCACGGTAGGTCCTTGG - Intronic
1016822219 6:148357507-148357529 AGGGAGCCTGGGTGGAAACTGGG - Intronic
1017501408 6:155026636-155026658 TGGCAGCCTGGGTGGCCCCTTGG + Intronic
1017880829 6:158561081-158561103 AGGCAGCCTCCGAGGGGCCTGGG + Intronic
1018036591 6:159887463-159887485 GGGGAGGCTGGGGGGGCCCTGGG + Intergenic
1018109330 6:160520231-160520253 TGGGAGCCGCAGCGGGCCCTAGG + Intergenic
1018975090 6:168558456-168558478 TGGGAGCCTCCCTGGTCCCTGGG + Intronic
1019143113 6:169960730-169960752 AGGGCGACTGGGTGGGGCCTTGG + Intergenic
1020292009 7:6729682-6729704 TGGGACCAACGGTGGGCCCTGGG + Intergenic
1024685942 7:51745122-51745144 TGGGAGACTGGGTGGGCCGTGGG + Intergenic
1025728172 7:64087208-64087230 ATGGGGCCTCAGAGGGCCCTGGG + Intronic
1025757290 7:64357099-64357121 CAGGAGCCTCAGAGGGCCCTGGG + Intergenic
1025854435 7:65265150-65265172 AGGGAGTCTAGGGGGACCCTGGG + Intergenic
1029699919 7:102239603-102239625 AGGGAGCGCCGGTCGGCCCAGGG + Intronic
1029705413 7:102273314-102273336 AGGGAGCCTGGTGGGACCCTTGG - Intronic
1032085972 7:128884134-128884156 AGTGAGCAGCGGTGGGTCCTGGG + Intronic
1032428692 7:131843047-131843069 AGGCAGCCTAGAAGGGCCCTGGG - Intergenic
1034480533 7:151317043-151317065 AGGGAGCTTTGGTGGGAGCTGGG - Intergenic
1035388105 7:158488260-158488282 AGGGAGCCCCAGGGGGTCCTAGG + Intronic
1035637112 8:1155662-1155684 TGGGGGCCTCGGAGGGGCCTGGG - Intergenic
1035637122 8:1155681-1155703 GGGAAGCCTCGGAGGGGCCTGGG - Intergenic
1037750873 8:21681522-21681544 ATGGAGTTTCGGTGGGTCCTGGG - Intergenic
1039470076 8:37807995-37808017 AGAGAGGCTCTGTGGGCTCTGGG - Intronic
1041303994 8:56441229-56441251 AGGGAGGCTTGCTGGGGCCTGGG + Exonic
1041661446 8:60405367-60405389 AGAGAGCCTCCGTGGGCGGTGGG - Intergenic
1046817139 8:118597185-118597207 AAGGAGCCCCCGTTGGCCCTAGG - Intronic
1049192089 8:141294186-141294208 AGGGTCCCTCGGTTGGCCCTGGG - Intronic
1049379148 8:142303383-142303405 GGGGCACCTCGCTGGGCCCTGGG - Intronic
1049795771 8:144496693-144496715 CAGGAGCCTGGGTGGGGCCTGGG - Exonic
1051921666 9:22274327-22274349 AGAGAGCCTCTCTGGGCACTGGG + Intergenic
1057428127 9:94970588-94970610 AGGGAGACTGCGTGGGGCCTTGG - Intronic
1057619108 9:96619427-96619449 CGGGAGCCTCGGCGGGCGCGCGG - Exonic
1060258538 9:122053641-122053663 AGGGAGCATGGGTGGGGACTGGG + Intronic
1060416890 9:123437067-123437089 AGGGAGCCTCTGGGGGGCCCTGG + Intronic
1060515548 9:124263597-124263619 AGTGACCCTGGGTGGGTCCTTGG - Intronic
1061720026 9:132545852-132545874 AGGGGTCCTCGGGAGGCCCTGGG - Intronic
1061809905 9:133156164-133156186 AGGGAGCCTGCATGGACCCTGGG - Intronic
1061937675 9:133867246-133867268 AGGGAGGCCTGGTGGGCACTGGG - Intronic
1062116570 9:134812600-134812622 AGGGGGACCCGGGGGGCCCTAGG - Exonic
1062331815 9:136048207-136048229 AGGGGCCCTGGGTGGGCCTTGGG + Intronic
1062395995 9:136353105-136353127 AGGGAGCCACGCTGGGTGCTTGG - Intronic
1062580741 9:137228256-137228278 AGGGAGCCGCAGGGCGCCCTGGG + Exonic
1062613922 9:137387595-137387617 AGGGTGCCTGGGAGAGCCCTGGG + Intronic
1193016302 X:76737954-76737976 AGGGAGCTTCTCTGGGCTCTAGG + Intergenic
1194954850 X:100166742-100166764 AGGGAGCCTCTCTGGGCACTGGG - Intergenic
1196768830 X:119273243-119273265 AGGCAGCCACGCTGGGCCTTCGG - Intergenic