ID: 1181314960

View in Genome Browser
Species Human (GRCh38)
Location 22:21964938-21964960
Sequence GCTGGAAAGCTGGTGGTCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 263}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181314960_1181314974 29 Left 1181314960 22:21964938-21964960 CCAGAGACCACCAGCTTTCCAGC 0: 1
1: 0
2: 2
3: 22
4: 263
Right 1181314974 22:21964990-21965012 AGACTGAGGAGATGAGGCTGAGG 0: 1
1: 0
2: 4
3: 78
4: 571
1181314960_1181314973 23 Left 1181314960 22:21964938-21964960 CCAGAGACCACCAGCTTTCCAGC 0: 1
1: 0
2: 2
3: 22
4: 263
Right 1181314973 22:21964984-21965006 GAGAAAAGACTGAGGAGATGAGG No data
1181314960_1181314972 15 Left 1181314960 22:21964938-21964960 CCAGAGACCACCAGCTTTCCAGC 0: 1
1: 0
2: 2
3: 22
4: 263
Right 1181314972 22:21964976-21964998 TTACTAAGGAGAAAAGACTGAGG 0: 1
1: 0
2: 0
3: 25
4: 372
1181314960_1181314966 1 Left 1181314960 22:21964938-21964960 CCAGAGACCACCAGCTTTCCAGC 0: 1
1: 0
2: 2
3: 22
4: 263
Right 1181314966 22:21964962-21964984 CAACCCCCTCCTCGTTACTAAGG 0: 1
1: 0
2: 0
3: 6
4: 65
1181314960_1181314975 30 Left 1181314960 22:21964938-21964960 CCAGAGACCACCAGCTTTCCAGC 0: 1
1: 0
2: 2
3: 22
4: 263
Right 1181314975 22:21964991-21965013 GACTGAGGAGATGAGGCTGAGGG 0: 1
1: 0
2: 4
3: 45
4: 482

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181314960 Original CRISPR GCTGGAAAGCTGGTGGTCTC TGG (reversed) Intronic
900692990 1:3992905-3992927 GCTGGAAAGCTGTAAGTTTCGGG + Intergenic
900905593 1:5554900-5554922 CCAGGGAAGGTGGTGGTCTCTGG - Intergenic
901032100 1:6313129-6313151 GCTGCTAAGCTGGTGGTGTCTGG + Intronic
901583546 1:10266499-10266521 GCATGAAAGCTGGTGGTGGCAGG - Intronic
902385251 1:16072589-16072611 GTTGGAAAGCTGGTGGTGATGGG + Intronic
903141002 1:21339112-21339134 GCTGGGGAGCTGGGGATCTCAGG + Intronic
903794433 1:25918245-25918267 GCTGGGAAGCTGGGGGTGGCTGG + Intergenic
904301625 1:29557951-29557973 GCTGGGCAGCTGTTGGCCTCTGG - Intergenic
905457786 1:38100458-38100480 GCTGCAAACCTGGTGGCCACAGG + Intergenic
906193665 1:43915202-43915224 GCTGAAGAGCTGCTGGTCACTGG + Intronic
909071626 1:71001068-71001090 ACTGGAAAGCAGGTGGTCTAGGG + Intronic
910739010 1:90494799-90494821 GGGGGAAAGCTGGTGGTCCCAGG + Intergenic
912370818 1:109172773-109172795 GCTGGAAAGCTGCTGGTCTTTGG - Intronic
912625269 1:111200906-111200928 ACTGGAAACCGGCTGGTCTCAGG + Exonic
913992798 1:143630393-143630415 GGAGGAAAGCAGGTGGCCTCTGG + Intergenic
914510811 1:148330245-148330267 GCTGCAAAGCTGGTGGTGAACGG - Intergenic
915457432 1:156050254-156050276 GCTGGAGAGCTGGAGGACACTGG - Intronic
915973546 1:160370652-160370674 GCTTGAAAGCTGGTGGTGGGAGG - Exonic
916717447 1:167457143-167457165 GCTGGCATGGTGGGGGTCTCAGG + Intronic
917534056 1:175861844-175861866 GCTGGAACAATAGTGGTCTCAGG + Intergenic
920210218 1:204322555-204322577 GCTGCTTAGCCGGTGGTCTCAGG + Intronic
920278771 1:204828263-204828285 GCCGGACAGCTTGTGTTCTCAGG - Intergenic
922938588 1:229440485-229440507 GCTGCAAACCTGGTGATCCCTGG - Intergenic
923135838 1:231117938-231117960 GATGGCAAGCATGTGGTCTCTGG - Intergenic
923340424 1:233002031-233002053 TCTGGGGAGCTGGTCGTCTCTGG - Intronic
923533362 1:234829275-234829297 ACGTGAAAGTTGGTGGTCTCTGG + Intergenic
924770417 1:247074983-247075005 TCTGGAAATCTGGTGTTCACAGG - Intronic
1062805444 10:416301-416323 GGCTGAATGCTGGTGGTCTCTGG - Intronic
1064067871 10:12198751-12198773 GATGGAACTCTGGTGGTTTCAGG + Exonic
1064416542 10:15154905-15154927 GATGGCAAGCATGTGGTCTCTGG - Intronic
1067549313 10:47222445-47222467 GCTGGAAAGCTCAGGGTCTGGGG + Intergenic
1069138952 10:64800122-64800144 GCTGGAGAGCAGTTGGCCTCAGG - Intergenic
1070645982 10:78202901-78202923 GCTGCATAGCTGGTGGGCCCAGG + Intergenic
1071391587 10:85180596-85180618 GCAGGAAAGGTGGTGGTGTTTGG - Intergenic
1075065502 10:119286653-119286675 GCTGGGAAGTTTGTTGTCTCCGG + Intronic
1076287169 10:129311535-129311557 GCTTGAAAGCTGCTGGCCTATGG - Intergenic
1076798053 10:132808300-132808322 TCTGGAAAGCTGCTGGGTTCAGG + Intergenic
1077203546 11:1327274-1327296 ACAGGAAAGCTGGAGTTCTCAGG + Intergenic
1078762140 11:14259927-14259949 GGTGGCAAACTGGTGGCCTCTGG + Intronic
1080087119 11:28296899-28296921 GCTGGCAAGCTGCTGGGTTCTGG - Exonic
1080395397 11:31885549-31885571 GCTGGAGAGCTGGTGCTGTGGGG - Intronic
1080613410 11:33925156-33925178 ACTGGAAAGCTGGAGATCTAGGG - Intergenic
1081537472 11:44006049-44006071 GCTGGAACCCTGGAGGTCGCTGG - Intergenic
1082251052 11:49980722-49980744 GCTGGAATACTGGTGGGCTTAGG - Intergenic
1082879365 11:58023103-58023125 GATGGAAAGATGGTGGGCTCTGG + Intergenic
1088675518 11:112188708-112188730 GATGGAAAGCTGGGGGAATCAGG - Intronic
1089423565 11:118350718-118350740 GGAGGAAAGCTGAGGGTCTCAGG - Intronic
1089494234 11:118900341-118900363 GCTTGAAGACTGGTGGGCTCTGG - Intronic
1089508180 11:118979013-118979035 CCTGGAAAGCTGGAGGTCTCAGG + Exonic
1089748218 11:120631865-120631887 GCTCCAAGGCTGGGGGTCTCTGG - Intronic
1090895042 11:130964489-130964511 ACGGGAAAGCTGGTAGTCACAGG + Intergenic
1090895061 11:130964621-130964643 GCTGGGAAGCTGGTAGCCTGGGG - Intergenic
1091034902 11:132224288-132224310 GCCTGAAGGCTGATGGTCTCGGG + Intronic
1091302071 11:134514300-134514322 GCTGAGAAGCTTGTGGTCCCTGG + Intergenic
1091809963 12:3389009-3389031 GCTGGCAAGCAGGTGGTCCTGGG - Intronic
1094324654 12:29223752-29223774 TCTGAAAAGCTGCTGGTCTTGGG + Intronic
1094446018 12:30531361-30531383 TTTGGAAAGGGGGTGGTCTCTGG + Intergenic
1095492535 12:42749507-42749529 GCAGGAAAGTTTGTGTTCTCTGG + Intergenic
1097072493 12:56365425-56365447 GCAGAATAGCTGGTGATCTCTGG + Intergenic
1098358555 12:69633306-69633328 GCTGGAAAGTGGCTGGTCTAAGG - Intergenic
1100315494 12:93441550-93441572 GCGGCAAGGCTGGGGGTCTCTGG - Intronic
1102050364 12:109857512-109857534 GCTGAAAAGGTGATGGGCTCAGG - Exonic
1102241938 12:111329936-111329958 GCTGGAAAACTGACGGTCTTTGG - Intronic
1102584249 12:113912117-113912139 AGTGGAAGGCTGGTGGCCTCCGG + Intronic
1103733577 12:123044243-123044265 GCTGAAATGGTGGTGGCCTCAGG - Intronic
1105019822 12:132808657-132808679 GCTGGGGAGGTGGTGCTCTCTGG - Intronic
1105642408 13:22279371-22279393 GCTGGAAAGCTGTTTCTCCCAGG + Intergenic
1105781218 13:23706453-23706475 GCTGAAAAGCAGGTGTTCTGTGG + Intergenic
1106713264 13:32360799-32360821 GGTGGAAAGCAGTTGGACTCTGG + Intronic
1108391538 13:49952326-49952348 TCTGGATAGCTGGAGGTTTCTGG - Intergenic
1110118997 13:71858650-71858672 ACTGGAGAGCTGTTGGTCTAAGG - Intronic
1110181753 13:72625868-72625890 GCAGGGAGGCTGGTGGTCTGGGG + Intergenic
1110340959 13:74389155-74389177 GCAGGGAGGCTGGTGGTCTGGGG - Intergenic
1111258014 13:85697844-85697866 GCTGGAAAGCAGTTTGCCTCAGG + Intergenic
1111666214 13:91272190-91272212 GATGGCAAGCATGTGGTCTCTGG - Intergenic
1112563431 13:100533130-100533152 GGTGGAAGGCTGGTGCCCTCAGG - Intronic
1112686597 13:101835701-101835723 ACTGGCAAGATGGAGGTCTCTGG + Intronic
1112757900 13:102659715-102659737 GCCTGAAAGCAGGTGATCTCTGG + Intronic
1113955099 13:114096109-114096131 GCTGGGAAGGGGGTGCTCTCTGG + Intronic
1117999970 14:61514049-61514071 GCTGGAATGCTGGTGCTATCTGG - Intronic
1118640783 14:67790410-67790432 GCTGGAAAACTGGACGTATCAGG + Intronic
1119209066 14:72816253-72816275 GCTGGGAATCTGTTGGTCCCAGG - Intronic
1121330587 14:93047087-93047109 ACTGGAAAGCTGGGGCCCTCAGG + Intronic
1121578880 14:95011524-95011546 GCTTCAAAGCTGGTGCTATCGGG - Intergenic
1122368498 14:101213709-101213731 GCTGGAAAGCTGCTGCTTTGGGG - Intergenic
1122539039 14:102486609-102486631 GCTGGAAAACTGCTGGTCTTCGG + Intronic
1124380706 15:29162522-29162544 GGTGGAAAGCTGGCAGTCACAGG - Intronic
1125759858 15:42088961-42088983 TCTGGAATGAAGGTGGTCTCTGG - Intronic
1126782649 15:52151549-52151571 GCTGGAAAGCAGGAAGCCTCTGG - Intronic
1127937682 15:63658469-63658491 GCTGGAAGTCTGGTGGTGTTTGG - Intronic
1128323468 15:66707865-66707887 GCTGGAAAGATGGGGGTGTAAGG + Intronic
1130422659 15:83763888-83763910 GGGGGCAAGCTGTTGGTCTCTGG - Intronic
1130573319 15:85068471-85068493 CCTGGATAGCTGCTTGTCTCTGG + Intronic
1132086501 15:98912400-98912422 GCTGGACAGCTGCTGGCCGCTGG - Intronic
1132523153 16:400794-400816 GATTGCAGGCTGGTGGTCTCTGG - Intronic
1132610617 16:814165-814187 GCTTGCAAGCCGGTGGCCTCCGG + Intergenic
1132863795 16:2083999-2084021 GCTGGGCAGCCTGTGGTCTCAGG + Intronic
1134674448 16:16079507-16079529 GTGGGGAAGCTGGTGGTCTGAGG + Intronic
1135563348 16:23493487-23493509 GGTGGAAAGCCAGTGGTCCCAGG + Intronic
1135597306 16:23754579-23754601 GCTGGAAGGCGGGTGGCCTATGG - Intergenic
1135944883 16:26857098-26857120 GCAGGAGACCTCGTGGTCTCCGG + Intergenic
1136071746 16:27791613-27791635 GGTGGAGAGCTGGTGGTGTTGGG - Intronic
1137314187 16:47299436-47299458 GGGGGAAAGCTGGTGGTGTTGGG + Intronic
1138624186 16:58236339-58236361 CCTGGAATGCTGCTGGTCCCTGG - Intronic
1139340489 16:66264968-66264990 TCTGGAATGCTGATGGGCTCCGG + Intergenic
1139523262 16:67497449-67497471 GCTGGAAAGGTGGGAGACTCTGG - Intergenic
1139661048 16:68421138-68421160 GCCGACATGCTGGTGGTCTCTGG - Intronic
1141399825 16:83737865-83737887 GCTGGAAAGCTGCATGACTCAGG + Intronic
1141477200 16:84281848-84281870 CCTGGAAAGTTGGTGTACTCTGG + Intergenic
1142132111 16:88435877-88435899 GCCGGAGAGCTGGAAGTCTCGGG - Exonic
1143264858 17:5628733-5628755 GATGGCAAGCTGGTGGCCCCAGG - Intergenic
1144467372 17:15507225-15507247 AATGGGAAGCAGGTGGTCTCTGG + Intronic
1145934075 17:28704930-28704952 GGTGGACAGCTGGTGGTGGCAGG - Intronic
1147884277 17:43674310-43674332 GCTGGAAGGCAGGTGCTGTCGGG + Intergenic
1149065539 17:52474989-52475011 GCTGGAAAGCTGGAACTTTCGGG + Intergenic
1149530694 17:57392568-57392590 GCTTGAACCCTGGTGCTCTCTGG + Intronic
1149686320 17:58537405-58537427 GATGGAAGGCTGGTGGCCTCTGG - Intronic
1151115617 17:71731813-71731835 GCTGGAAAGCTGCTGCTCTTGGG - Intergenic
1151657279 17:75501937-75501959 GCTGGAAGGCTGCTGGGCTCGGG + Exonic
1151728979 17:75899893-75899915 GCTGTCAAGCTGATGCTCTCTGG - Intronic
1154354807 18:13616667-13616689 GCTGTGAGGATGGTGGTCTCTGG + Intronic
1159454077 18:68638817-68638839 GCTGGGAAGCTGGTAGCCTGGGG - Intergenic
1161108279 19:2455330-2455352 GGTGGAATGGGGGTGGTCTCTGG - Intronic
1161964415 19:7540374-7540396 TCTGTAGAGCTGGTGGTCTTTGG + Intronic
1163675166 19:18652073-18652095 GCAGAAATGCTGGTGGGCTCAGG + Intronic
1165433155 19:35783770-35783792 GATGGAACTCAGGTGGTCTCAGG + Intronic
1166126733 19:40719099-40719121 GCTGGCAAGCTGATGGACTCCGG - Intronic
1166334751 19:42099013-42099035 GCTGGAAATGTGGTGCTTTCTGG + Intronic
1167420944 19:49402921-49402943 TCTGGGAAGAAGGTGGTCTCTGG + Intronic
1167420948 19:49402939-49402961 TCTGGGAAGAAGGTGGTCTCTGG + Intronic
1167636030 19:50656298-50656320 GCTGGGAAGCTGGTGGTGTGGGG - Exonic
925178130 2:1799047-1799069 GCTGCAGAGCTGGGGGACTCCGG + Intronic
925302252 2:2825756-2825778 GCTGGTGAGTTGGTGGTCTTGGG - Intergenic
925346444 2:3175238-3175260 CCTGGAAAGCTGGTGTTCTATGG - Intergenic
926572345 2:14543626-14543648 GCTGGAAAGCTTTCGCTCTCAGG - Intergenic
926586002 2:14686417-14686439 GCTGGGAAGATGGTGGCCTAAGG + Intergenic
926701176 2:15804711-15804733 TCAGGAAAGCCAGTGGTCTCAGG - Intergenic
929267904 2:39939781-39939803 GCTGGAGAGCTGTTTGTCTCAGG - Intergenic
930593073 2:53353418-53353440 GCAGGGAGGCTGGTGGTCTGAGG + Intergenic
930723807 2:54663587-54663609 GCTGGAAGCCTGGCTGTCTCTGG + Intronic
933702250 2:85263808-85263830 CCTCGAAAGCTGGTGTTCTCTGG - Intronic
933771413 2:85746756-85746778 GCTGGAAAGATGGTGGGATTTGG - Intergenic
933898734 2:86834262-86834284 GCTGGAAAGCTTGTGGCCAAGGG - Intronic
935781806 2:106514959-106514981 GCTGGAAAGCTTGTGGCCAAGGG + Intergenic
936229311 2:110686023-110686045 TTGGGAAAGCTGTTGGTCTCTGG - Intergenic
937308004 2:120884104-120884126 CCAGGAAAGCTGGTGTTCTGTGG - Intronic
938138152 2:128775749-128775771 GCTGGAAAGACGGAGGTCTGTGG + Intergenic
938413911 2:131088887-131088909 ACTGGAAAGTTGGTGGTTGCAGG - Intronic
938673724 2:133609635-133609657 GCTAGAAGCCTGGTTGTCTCTGG - Intergenic
940597730 2:155816151-155816173 GCTGGGATGCTAGAGGTCTCAGG - Intergenic
940895971 2:159082013-159082035 GCTGGGCAGCAGGTGGGCTCTGG - Intronic
942487790 2:176457379-176457401 TCTGGAAAGCAGGTGGCCTTTGG - Intergenic
942608874 2:177720572-177720594 GCTGGAAAGGTTCTGGTCTCTGG - Intronic
942956576 2:181781076-181781098 GTTGGAAAGATGGTGATCTGGGG + Intergenic
945536693 2:211026368-211026390 GCTGGGAAGCTGGTAGCCTGGGG - Intergenic
948478554 2:238236719-238236741 GCTGGGAAGCTGGTGGCCCCAGG + Intergenic
1170830795 20:19838922-19838944 GCTGACAAGCTGGTGTTGTCAGG - Intergenic
1172187488 20:33040165-33040187 GCTGGGAGGGTGGTGGTCTCTGG + Intronic
1173542282 20:43863129-43863151 GCCAGAAACCTGGTTGTCTCAGG + Intergenic
1173703733 20:45095132-45095154 GCTGGCAAGCTGGCAGCCTCAGG - Exonic
1174914432 20:54639966-54639988 GCTGCAGAGATGGTGGGCTCTGG - Intronic
1176198149 20:63847499-63847521 GCCCCACAGCTGGTGGTCTCTGG - Intergenic
1176362572 21:6010219-6010241 GCTGGAGGGCTGCTGGGCTCTGG + Intergenic
1179605879 21:42514658-42514680 GCTGGAAGGCTGGTGGCCAGCGG - Exonic
1179760946 21:43528326-43528348 GCTGGAGGGCTGCTGGGCTCTGG - Intergenic
1180216698 21:46328083-46328105 GCTGGAAAACTGGTGGCCAAAGG + Intronic
1181108032 22:20586142-20586164 TCTGGGAAGCTAGTGGCCTCTGG - Intronic
1181314960 22:21964938-21964960 GCTGGAAAGCTGGTGGTCTCTGG - Intronic
1182779321 22:32855115-32855137 CCTGGACTGCTGGTGGTCTCTGG - Intronic
1183364831 22:37401384-37401406 GCAGCAAAGCTGGTGGTCATGGG + Intronic
1183477351 22:38042856-38042878 GCTGCAAAGCTGGTGGCCGGAGG + Intergenic
1183511057 22:38235236-38235258 ACTGGAAAGCTGATAGTCTTGGG - Intronic
949310264 3:2689530-2689552 ATTGAAAAGCAGGTGGTCTCTGG - Intronic
953658607 3:44873731-44873753 GATGGCAAGCTTGTGGTCTTTGG + Intergenic
954534053 3:51344806-51344828 GCTGGAACACTGGTGGGCTTGGG - Intronic
957788404 3:84909813-84909835 TATGGGATGCTGGTGGTCTCTGG + Intergenic
958843625 3:99239049-99239071 GATGGAAAGCTGTTGGTCAATGG - Intergenic
960622266 3:119648307-119648329 GCAGGAAAGTTGGTGGTAGCTGG + Exonic
961113206 3:124303363-124303385 TCAGGAAAGCTGGTTGTCTGAGG - Intronic
961537905 3:127581005-127581027 ACAGGAGAGCTGGTGGTCTGGGG + Intronic
961809105 3:129511271-129511293 CCTGGAAAGGATGTGGTCTCAGG + Intronic
963138348 3:141928293-141928315 GATGCAAAGCTGGTTGTCTTTGG - Intergenic
963373920 3:144438330-144438352 GCGGGGAGGCTGGTGGTCTGAGG - Intergenic
964422584 3:156519767-156519789 GCAGGAAAACTGGTGGTTGCAGG + Intronic
965385239 3:168037992-168038014 GCAGGAATGCTGGTGGGTTCTGG - Intronic
965559611 3:170048954-170048976 ACTGGTAAGGTGGTGGCCTCAGG - Intronic
966229962 3:177640989-177641011 GCTGGGAAGCTCATGGTCTGGGG - Intergenic
966352555 3:179046582-179046604 GCTGGGAGGCTTGTGGTCTGGGG + Intronic
967307591 3:188074326-188074348 GCTGGAAAGATTAAGGTCTCTGG + Intergenic
968628674 4:1639108-1639130 GCTGGCATGGTGGTGGTGTCAGG - Intronic
971207291 4:24583660-24583682 GCTGGAAGGCTGGTGTTTTGGGG - Intronic
971242780 4:24903471-24903493 GATGGAAACCTGATGGGCTCGGG + Intronic
971365365 4:25972601-25972623 GCTGGTGATCTGATGGTCTCTGG + Intergenic
975110079 4:70613593-70613615 GCTGGAAAGCTGCTGAACCCTGG - Intergenic
975800811 4:78057675-78057697 GCCGGAAAGTTGCTGGTCACTGG - Exonic
978498067 4:109381044-109381066 GCTGGAAAGCTGCCAGTCACAGG + Intergenic
979161914 4:117472506-117472528 GATGGAAGGGTGGAGGTCTCAGG + Intergenic
979767937 4:124484794-124484816 TTTGGAAAACTGCTGGTCTCCGG + Intergenic
980409996 4:132404232-132404254 GCAGGGAGGCTGGTGGTCTGGGG - Intergenic
982269179 4:153569230-153569252 GCTGGAAATCGGCTGATCTCAGG - Intronic
982918898 4:161249787-161249809 GCTGGAAAGGAGCAGGTCTCTGG - Intergenic
986060715 5:4187706-4187728 GTGGGAAAGATGGTGGTCCCTGG + Intergenic
987071606 5:14342165-14342187 CCTGGGAAGCAGGTGCTCTCTGG + Intronic
987157357 5:15103295-15103317 GCAGGAAGGCTGGTGACCTCGGG + Intergenic
989427165 5:41309599-41309621 ACTGGAAAGTTGGAAGTCTCAGG - Exonic
989719362 5:44505605-44505627 GCTGGAAAGCAGTTTGCCTCAGG + Intergenic
992758167 5:79928801-79928823 GCTGGTAAGCTGGTGTGCTTTGG - Intergenic
993912709 5:93703968-93703990 GTTGCAAAGCTGGTAGGCTCAGG + Intronic
994598745 5:101873917-101873939 GCTGGATAGCTAGTGGTATGTGG - Intergenic
996128483 5:119753114-119753136 GATGGAAAGCTGGTAGCCTGGGG + Intergenic
996207975 5:120766209-120766231 CCTGGAATGCTGCTGGTGTCAGG - Intergenic
996491528 5:124103830-124103852 GCAGGAAAGCTGGTGCCCTCAGG + Intergenic
996795559 5:127342893-127342915 GCCTGGAAGCTGTTGGTCTCTGG + Intronic
997370212 5:133354807-133354829 GGTGGAAAGATGGTGCTCCCGGG - Intronic
997425698 5:133801252-133801274 CCTGAAAAGCAGTTGGTCTCTGG - Intergenic
999089864 5:148926752-148926774 GCTGGGAAGGTGGTGGTCGGGGG - Intronic
999634902 5:153611573-153611595 GGTGGAAAACTGGTGGTCAGTGG + Intronic
1000022320 5:157328635-157328657 GCTACAAAGCTGGTGTGCTCTGG - Intronic
1001723949 5:173880848-173880870 GCTGGAAGGCTAGTGATGTCAGG - Intergenic
1005327761 6:24719790-24719812 GGTGGAAGGCAGGTGGTCTCCGG - Exonic
1007197318 6:40073948-40073970 GCTGGGAAGCTCGTAGTCTGGGG - Intergenic
1007670547 6:43549470-43549492 GCTGGTAAGCTGCTGGACCCTGG - Exonic
1008129840 6:47708357-47708379 GTTGGAAAGCCTGTGGTCTGGGG - Intronic
1009589093 6:65643110-65643132 GCAGGGATGCTGGTGGTCTGAGG + Intronic
1010008921 6:71028038-71028060 TCTGGAAAGCTAATGCTCTCTGG - Intergenic
1012497151 6:99846114-99846136 GCTATAAAGCAGGTGGTATCAGG - Intergenic
1012506136 6:99948440-99948462 CCTGGAAAGCTGGTGCTGACTGG - Intronic
1014313224 6:119830944-119830966 GCTGGAAGGCTGGTAGACTGAGG - Intergenic
1015015900 6:128412616-128412638 GCAGGAATGCTAGTGTTCTCTGG - Intronic
1015289207 6:131519662-131519684 GCTGGTATGGTGGAGGTCTCAGG + Intergenic
1019118303 6:169783501-169783523 GCTGCAAAGCTGGGGCTTTCCGG + Intergenic
1022906835 7:34865955-34865977 TCTGTAAAGCAGGTGGACTCTGG - Intronic
1024537485 7:50450187-50450209 TCTGGAATGCTGGGGGTCGCGGG - Intronic
1024730319 7:52246548-52246570 GCTGGCAGGCTGGTGGCCTAGGG + Intergenic
1025607025 7:63046945-63046967 GCTGGAAAGCACGTGGCCTGTGG - Intergenic
1026113137 7:67474359-67474381 GCTGGCAAGCTGGTGCTGGCTGG + Intergenic
1027865467 7:83640469-83640491 GCTGGGAAGCTGATGCTCTCAGG - Intronic
1028255557 7:88592061-88592083 GCTGGAAGTATGGAGGTCTCAGG - Intergenic
1030961361 7:115927538-115927560 GATGAAAAGATGGTGGCCTCTGG + Intergenic
1032451533 7:132035908-132035930 GCTGGAAAGCAGGTGGGGCCAGG + Intergenic
1032856806 7:135841842-135841864 GCTGTAATGCTGGGGCTCTCAGG + Intergenic
1033600450 7:142885269-142885291 GCTGGACAGATGGTGCTCCCAGG - Intronic
1034065212 7:148129796-148129818 ACTGGATGGCTGATGGTCTCCGG - Intronic
1035845724 8:2862140-2862162 GCTGAAAATCTGGTGTTTTCAGG + Intergenic
1036681821 8:10879857-10879879 GCAGGGAATCTGGTGGACTCTGG - Intergenic
1037270187 8:17118560-17118582 GCTGGAAGGCTGGGGGACTGGGG - Intronic
1037654583 8:20872223-20872245 GCTGGGTGGCTGGGGGTCTCAGG - Intergenic
1037872398 8:22510599-22510621 GATGGAAAGCTGCTGGACTGCGG - Intronic
1037912674 8:22753301-22753323 TCTGGAAACCTGCTTGTCTCTGG - Intronic
1038219425 8:25593394-25593416 TCTGGAAAGCTGTGGGTCTTGGG + Intergenic
1038718113 8:30009836-30009858 CCTGGAAAGCATTTGGTCTCTGG - Intergenic
1038977806 8:32720486-32720508 GCTTGAAAGTTTGTGGACTCCGG + Intronic
1039079057 8:33718085-33718107 TCTGTAAAGCTGCTGGCCTCTGG + Intergenic
1039943708 8:42112521-42112543 TCTGGAATGCTGGTTTTCTCAGG - Intergenic
1041469594 8:58193884-58193906 GCTGGAAAGTTGGTGGGACCAGG + Intronic
1045174440 8:99706640-99706662 GCTAGAAAACTGCTGGCCTCAGG + Intronic
1045889910 8:107143378-107143400 ACAGGAATGCTGCTGGTCTCAGG - Intergenic
1046591462 8:116212217-116212239 GCTGGGAGGCTGTTGGTCTAGGG - Intergenic
1048218726 8:132520908-132520930 GCTGGAAAGCAATGGGTCTCTGG - Intergenic
1049187318 8:141263961-141263983 AAAGGAAAGCTGGTGGCCTCCGG + Intronic
1051279818 9:15431154-15431176 GCAGGAAAGCTGCTGGGCGCGGG - Intronic
1053137620 9:35661359-35661381 GCGGGCATGCTGGTGGCCTCAGG - Exonic
1055674416 9:78640819-78640841 GCAGGAAAGCTGTTCGTTTCTGG + Intergenic
1056467846 9:86876556-86876578 GCGGGAAGGCTGGAGGTTTCTGG - Intergenic
1057808797 9:98241690-98241712 GCTGGATAGCTGGACTTCTCAGG + Intronic
1059143215 9:111874057-111874079 GCTGGAAAGCTGGGTTTATCTGG + Intergenic
1059429819 9:114243349-114243371 GCTGGCCACCTGGTGGACTCAGG + Intronic
1060213927 9:121726961-121726983 CCTGGAATGCTGGTGGGCTGGGG + Intronic
1061105086 9:128523791-128523813 GCTGCACAGCTGGTTGCCTCGGG - Exonic
1061758445 9:132832905-132832927 CCTGGAGAGCTGGTGGCCTAGGG - Intronic
1062591460 9:137276613-137276635 GGTGGAATGCTGGTGCTCTTTGG - Intergenic
1062703378 9:137919816-137919838 GCTGAAAAGCTGGTGGCAGCGGG + Intronic
1186970322 X:14834885-14834907 TCTGGAAAGCAGTTGGTCCCTGG - Intergenic
1187735707 X:22301964-22301986 GCTGGTGAGTTGGTGGTCCCAGG + Intergenic
1189761283 X:44324082-44324104 GTTAGAAATCTTGTGGTCTCAGG - Intronic
1189985864 X:46552828-46552850 GTTGCAAATCTTGTGGTCTCTGG - Intergenic
1191257744 X:58287054-58287076 GCTGGAAAGGCACTGGTCTCTGG - Intergenic
1192970287 X:76221364-76221386 GAGGGAAAGCTGGCAGTCTCAGG + Intergenic
1193404213 X:81082394-81082416 GCTGGAAGGCTGGTAGCCTGGGG + Intergenic
1193638717 X:83985079-83985101 GATGGAGAGCTGGTGAGCTCAGG - Intergenic
1195626331 X:107008372-107008394 GGTGGGAAGCTGTTGGTCTAGGG - Intergenic
1195972877 X:110492250-110492272 GCGGGCAGGCTGGTGGTCTGGGG - Intergenic
1196023995 X:111020870-111020892 GGTGGAAAGCTGGCAGTCACAGG - Intronic
1196174625 X:112627338-112627360 GATGGAAAGGTTCTGGTCTCTGG - Intergenic
1197770698 X:130087314-130087336 GCTGGAAAGCCGATGATCTTAGG - Intronic
1200332638 X:155313764-155313786 GCTGGGAGGCTGGTGGTCTGGGG + Intronic
1200457837 Y:3414522-3414544 GCTGGGTTACTGGTGGTCTCTGG + Intergenic
1201315784 Y:12644081-12644103 GGGGGAAAGCTGGTAGTCACAGG - Intergenic