ID: 1181316714

View in Genome Browser
Species Human (GRCh38)
Location 22:21975267-21975289
Sequence GCCCCAGGCATTGTCACCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 214}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181316714_1181316717 2 Left 1181316714 22:21975267-21975289 CCAGGGGTGACAATGCCTGGGGC 0: 1
1: 0
2: 1
3: 19
4: 214
Right 1181316717 22:21975292-21975314 AGCCTCATCAGACCTTGACTGGG 0: 1
1: 0
2: 2
3: 7
4: 103
1181316714_1181316716 1 Left 1181316714 22:21975267-21975289 CCAGGGGTGACAATGCCTGGGGC 0: 1
1: 0
2: 1
3: 19
4: 214
Right 1181316716 22:21975291-21975313 TAGCCTCATCAGACCTTGACTGG 0: 1
1: 0
2: 0
3: 6
4: 72
1181316714_1181316721 14 Left 1181316714 22:21975267-21975289 CCAGGGGTGACAATGCCTGGGGC 0: 1
1: 0
2: 1
3: 19
4: 214
Right 1181316721 22:21975304-21975326 CCTTGACTGGGGTGTAGTCCTGG 0: 1
1: 0
2: 0
3: 5
4: 107
1181316714_1181316718 3 Left 1181316714 22:21975267-21975289 CCAGGGGTGACAATGCCTGGGGC 0: 1
1: 0
2: 1
3: 19
4: 214
Right 1181316718 22:21975293-21975315 GCCTCATCAGACCTTGACTGGGG 0: 1
1: 0
2: 1
3: 9
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181316714 Original CRISPR GCCCCAGGCATTGTCACCCC TGG (reversed) Intronic
900033107 1:385503-385525 GTCCCCTGCTTTGTCACCCCTGG + Intergenic
900053948 1:615393-615415 GTCCCCTGCTTTGTCACCCCTGG + Intergenic
900192778 1:1358517-1358539 GCCCCAGGCTTTGTCCCACTCGG + Exonic
900311455 1:2035440-2035462 GCTCCAGGCATTCTCCTCCCTGG + Intergenic
900540218 1:3198961-3198983 GCCCCAGGCATTGTCTGTCGCGG + Intronic
901055413 1:6446820-6446842 GCCCAAGGCAAAGCCACCCCAGG + Intronic
902478959 1:16701765-16701787 GCCCAAGGCAAAGCCACCCCAGG - Intergenic
902988606 1:20170907-20170929 GCCCCAGGCAGTGGCACTGCTGG - Intronic
903363070 1:22789196-22789218 ACCCCAGGGATTGTCCTCCCTGG + Intronic
903655572 1:24947178-24947200 GCCCTAGGCCTTGTCACCTGGGG + Intronic
909878974 1:80848519-80848541 GCCCCAGGCAATGAGCCCCCAGG + Intergenic
912801520 1:112722694-112722716 TCCCCACGCATTGTAAGCCCTGG + Intronic
915590641 1:156868378-156868400 AGCCCAGGCGATGTCACCCCAGG - Intronic
916510676 1:165469995-165470017 GCACCAGGCCTTGCCACTCCTGG - Intergenic
916618571 1:166471455-166471477 GCTCCAGGCTTTGTGACTCCAGG - Intergenic
920179139 1:204121938-204121960 GCCCCAGGCCTCTTCACCACTGG - Exonic
920440709 1:205978789-205978811 GCCCCGAGCCTGGTCACCCCAGG - Exonic
921971599 1:221155077-221155099 CCCCCAATCATTCTCACCCCAGG - Intergenic
922468553 1:225861587-225861609 GCCCCAGGCATTGTGACACTAGG - Intronic
923763540 1:236870575-236870597 ACCCCAGGCCTTGTTACTCCAGG - Intronic
923918455 1:238535975-238535997 GACTCAGGCTCTGTCACCCCGGG - Intergenic
924336670 1:242992523-242992545 GTCCCCTGCTTTGTCACCCCTGG + Intergenic
1063608240 10:7541569-7541591 GCCTCAGGGATTCTCACCTCCGG + Intergenic
1063979629 10:11443307-11443329 GCTCCAGGCATCGCCACCTCGGG - Intergenic
1064094895 10:12416981-12417003 GGCCCAAGCAGTGTGACCCCGGG - Intronic
1068010040 10:51436958-51436980 TAGCCAGGCCTTGTCACCCCTGG + Intronic
1068226104 10:54108638-54108660 GCTCCAGCCATTGTCACCGTAGG - Intronic
1069850594 10:71401758-71401780 GCCCCAGTCATTATGCCCCCGGG - Intronic
1071823986 10:89306243-89306265 GACCCAGGCATAGTTTCCCCAGG - Exonic
1072296267 10:94012088-94012110 GCACCAGGCAGTCTCACCCTGGG - Intronic
1074276977 10:112012573-112012595 GCCCCAGGCCAGGTCATCCCTGG - Intergenic
1074376643 10:112946436-112946458 GCCACAGGCTGTGTCACCCACGG - Intergenic
1074767207 10:116708092-116708114 GCCCCAGGAATGGGCCCCCCGGG + Intronic
1076922218 10:133459937-133459959 GTCCCAGGCATCGTCACACACGG - Intergenic
1077473657 11:2776453-2776475 GCACCAGGCAGTGTCTTCCCAGG - Intronic
1077664145 11:4093062-4093084 GCCCCAGGTATACCCACCCCAGG - Exonic
1079417355 11:20251863-20251885 ACCACAGGCATTGTCAGCCCAGG - Intergenic
1081709046 11:45205345-45205367 GCCCCAGGCAGGGTCACCCAGGG + Intronic
1083888608 11:65584854-65584876 GTCCCCGGGATTGGCACCCCGGG - Intronic
1083895001 11:65615589-65615611 GACCCAGGCGTTGCCAACCCAGG - Intronic
1084714395 11:70864438-70864460 GCTCCAGCCAATGTCAGCCCAGG + Intronic
1086861539 11:91930634-91930656 GTCCCAGACATTATCACCTCAGG - Intergenic
1089136279 11:116251834-116251856 CCCTCAGGCATTGCCACTCCTGG - Intergenic
1090402467 11:126458011-126458033 CCCCCAGGCCTCGGCACCCCCGG + Intronic
1091315042 11:134608695-134608717 GCACCAGGCCTTCTCACCTCAGG + Intergenic
1096799189 12:54098224-54098246 GCCCCAGGCATTATTTCCCCAGG + Intergenic
1098552025 12:71773277-71773299 TCTCCAGGCATTGCCATCCCCGG - Intronic
1099891310 12:88592201-88592223 ACCCCAGGCATTGTCATCATTGG + Intergenic
1104625924 12:130354606-130354628 GGCCCTGGCAGTGTCCCCCCAGG - Exonic
1104709114 12:130972849-130972871 GTCCCAGGCATTGGAACCCCTGG - Intronic
1104765672 12:131328420-131328442 TCTCCAGGCATAGTTACCCCTGG - Intergenic
1104813599 12:131633440-131633462 TCTCCAGGCATAGTTACCCCTGG + Intergenic
1104813618 12:131633506-131633528 TCTCCAGGCATAGTTACCCCTGG + Intergenic
1104813634 12:131633571-131633593 TCTCCAGGCATAGTTACCCCTGG + Intergenic
1104813654 12:131633637-131633659 TCTCCAGGCATAGTTACCCCTGG + Intergenic
1104831900 12:131758122-131758144 GCCCCAGGGTTTGTGAGCCCAGG + Intronic
1106003546 13:25747628-25747650 TCCCCACGCATTGTATCCCCAGG - Intronic
1106126472 13:26903791-26903813 GCTCCAGGCTTTGTGACTCCAGG + Intergenic
1106268172 13:28128449-28128471 GCCCCATGCAGTGTCACCCAGGG - Intergenic
1106539058 13:30674116-30674138 ACCCCAGGCGTTGCCACCCCAGG + Intergenic
1106914864 13:34502262-34502284 GCCAAAAGTATTGTCACCCCAGG + Intergenic
1107566824 13:41613596-41613618 GCCCCAGGCAAAGTCACACTGGG + Intronic
1107721187 13:43250186-43250208 GCCCCAGGCAGTGATACCCCAGG + Intronic
1107723787 13:43277018-43277040 GCCTCAGGCATGGTGACCCCTGG + Intronic
1108731675 13:53241879-53241901 GGCTCAGGCAATGTCACCCCTGG - Intergenic
1111253648 13:85638950-85638972 GTCACAGGCATTGGCACACCTGG + Intergenic
1111924105 13:94444693-94444715 TCCCCAGAGCTTGTCACCCCAGG + Intronic
1115148747 14:30258515-30258537 TACCCAGGCATTGTCACTCTTGG - Intergenic
1116019236 14:39441208-39441230 GCCCCAGGCATGCACACACCTGG - Intergenic
1117189252 14:53274752-53274774 GCCCCAGGCTTTGTGCCCCATGG - Intergenic
1119998556 14:79278826-79278848 GCCCTGGGCATTTTAACCCCGGG + Intronic
1120785889 14:88535350-88535372 ATCTCAGGCATTGTCACCCGGGG - Intronic
1121339524 14:93096965-93096987 GACCCAGGTATTGTCAGTCCTGG - Intronic
1122517743 14:102320217-102320239 CACCCTGGCATTTTCACCCCAGG + Intronic
1123171538 14:106377549-106377571 GCCCCAGGCTTCTTCACCTCAGG + Intergenic
1125689531 15:41585224-41585246 GCCCCAGGCATTTCTACCCACGG + Intergenic
1125930165 15:43594362-43594384 GCCTCAGGCACTGTTACCTCGGG - Exonic
1125943333 15:43694194-43694216 GCCTCAGGCACTGTTACCTCGGG - Exonic
1126779403 15:52125747-52125769 GCCCCAGGCAACTTCACTCCAGG - Intronic
1129328189 15:74812978-74813000 GCCCCAGGCAATGCCAGCCTTGG - Exonic
1129702029 15:77773709-77773731 GGCCCAGGCTGTGTGACCCCAGG - Intronic
1130178127 15:81596157-81596179 GCTCCAGGGATTTTCTCCCCTGG - Intergenic
1131509964 15:93044469-93044491 GCCCCAGGCAGGGCAACCCCGGG - Intronic
1132733459 16:1374470-1374492 GCCCCAGGCAACCGCACCCCGGG + Intronic
1132756355 16:1487328-1487350 GCAGCAGGCATGGTCCCCCCAGG - Exonic
1133210982 16:4263460-4263482 GTCTCAGGCTTTGCCACCCCAGG + Intronic
1133332169 16:4981584-4981606 GAGCCAGGCACTGTCCCCCCGGG - Intronic
1133801966 16:9091820-9091842 GCCCCAGGCCTTCCCACCCCCGG - Exonic
1133944906 16:10340012-10340034 GCTCCAGGCTTTGTGACTCCAGG + Intronic
1136616950 16:31404147-31404169 GACTCAGGAATTGTCACCCAAGG + Intronic
1139431641 16:66913913-66913935 GCCATGGGGATTGTCACCCCGGG - Intronic
1141801946 16:86315713-86315735 GCCTGGGGCATTGTCAGCCCAGG - Intergenic
1142286215 16:89172518-89172540 CCCCCAGGCCTGATCACCCCAGG - Intronic
1142373235 16:89694462-89694484 GCCCCTGCACTTGTCACCCCGGG + Intronic
1143218062 17:5239911-5239933 GCTCCAGGCTTTGTGACTCCAGG - Intergenic
1145026401 17:19471019-19471041 GCCCCAGGCTTTGACTCCACGGG + Intergenic
1145276912 17:21437029-21437051 GCCCCAGGCTTTGACTCCACGGG + Intergenic
1145314744 17:21722922-21722944 GCCCCAGGCTTTGACTCCACGGG + Intergenic
1147544996 17:41394239-41394261 GACCCAGGCATTCTTACCCTTGG - Intronic
1147583201 17:41638345-41638367 CCCCCAGGCACTCCCACCCCTGG + Intergenic
1148460528 17:47836872-47836894 TCCCCAGCCATGGGCACCCCAGG - Exonic
1152083088 17:78200640-78200662 GCCCCAGGCCTTGGAACGCCTGG + Intronic
1152584559 17:81183230-81183252 CCCCCAGCCGTTGTCACCCATGG - Intergenic
1160746021 19:710867-710889 TCCCCACCCATTGTCAGCCCGGG - Intronic
1162331712 19:10033886-10033908 GCTCCAGCCTTTGTGACCCCAGG + Intergenic
1162523015 19:11193116-11193138 GCCCCAGGCCTGGCCACCGCCGG - Exonic
1163156765 19:15443945-15443967 GCTCCAGGCATTGGCTCCACAGG - Intronic
1164715648 19:30388505-30388527 GCCCCGGGCATGGCCACCGCTGG - Intronic
1167159217 19:47756421-47756443 GCCCCATGCAGTCTCCCCCCAGG - Intronic
1168255933 19:55165335-55165357 GACCCAGGCATTCTGACCGCTGG - Intronic
1202713000 1_KI270714v1_random:27672-27694 GCCCAAGGCAAAGCCACCCCAGG - Intergenic
925028098 2:625330-625352 GCCCCAGGCATCGCCTCTCCTGG + Intergenic
925151373 2:1617778-1617800 TCCCCAGGCACCGTCTCCCCAGG + Intergenic
925712428 2:6754380-6754402 GCCCCAGACTTTGTCATCTCAGG - Intergenic
927509104 2:23633195-23633217 GTCCCTGGCATTGTCTTCCCTGG + Intronic
927640817 2:24844297-24844319 GTCCCAGGCATTACCACCCTGGG + Intronic
927812165 2:26186232-26186254 GCCGCTGCCATTGCCACCCCGGG - Exonic
929944796 2:46362145-46362167 GCCACAGGAACTGTCACCCTGGG - Intronic
933173957 2:79156266-79156288 GCCCCAGGCTCTGTGACCCCAGG - Intergenic
934119175 2:88823742-88823764 GCCTCAGGCTTTCTCAGCCCTGG - Intergenic
934615291 2:95766974-95766996 GCTCCAGGCTTTGTGACTCCAGG + Intergenic
934645615 2:96057585-96057607 GCTCCAGGCTTTGTGACTCCAGG - Intergenic
934839019 2:97613674-97613696 GCTCCAGGCTTTGTGACTCCAGG - Intergenic
937278410 2:120701284-120701306 TCCCCCGCCACTGTCACCCCAGG - Intergenic
940292422 2:152090248-152090270 GCCCCAGACAGGGTCAACCCTGG - Intronic
940830874 2:158463912-158463934 GCCCCAGGGATCCTCACTCCTGG - Intronic
942989601 2:182183558-182183580 GCCCCAAGCTTTGTCAGCCTAGG + Intronic
943596651 2:189865665-189865687 TCCCCAGGCTTTGTCATCCAAGG - Intronic
946174460 2:217913880-217913902 GCCCCAGGCAGGGTCACCAAGGG + Intronic
946438470 2:219675345-219675367 GCCCCAGGCAAAGACACCGCTGG + Intergenic
947918529 2:233850154-233850176 GCCCCAGTCCCTGTCATCCCTGG - Intronic
948793726 2:240391821-240391843 GCCCCAGGAATGAGCACCCCCGG + Intergenic
948931920 2:241137479-241137501 GCCCCAGGCACAGCAACCCCAGG + Intronic
1169336516 20:4761234-4761256 GCCTCTGGCATCCTCACCCCCGG + Intergenic
1169632338 20:7647510-7647532 GGCCCACCCATGGTCACCCCTGG - Intergenic
1169661804 20:7986722-7986744 TCCCCAGGTATTTTCTCCCCAGG - Intronic
1171170080 20:23008010-23008032 GTCCCAGGGCTTGTCAGCCCAGG + Intergenic
1171197626 20:23212684-23212706 GCCCCAGGCATTTGTTCCCCAGG - Intergenic
1171797233 20:29576122-29576144 GCCCCAGGCATTATTTCCCCGGG - Intergenic
1171851019 20:30308039-30308061 GCCCCAGGCATTATTTCCCCAGG + Intergenic
1171967651 20:31542577-31542599 GCACCAGGTATCTTCACCCCAGG + Intronic
1172523176 20:35582366-35582388 GCCCCAGGATCTGGCACCCCTGG - Intergenic
1174898044 20:54471402-54471424 GCCCCAGTCACTCTCACCACAGG - Intergenic
1176114297 20:63424376-63424398 GCCCCAGGAACGGGCACCCCAGG + Intronic
1178921708 21:36743187-36743209 GCCCCAGGCTGGGCCACCCCAGG - Intronic
1181316714 22:21975267-21975289 GCCCCAGGCATTGTCACCCCTGG - Intronic
1181601224 22:23952958-23952980 ACCCCATGCATTGTCCCACCTGG - Intergenic
1181607288 22:23988376-23988398 ACCCCATGCATTGTCCCACCTGG + Intergenic
1185129737 22:49032219-49032241 GCCCCAGGCATCTTCTCCCATGG - Intergenic
949507119 3:4738608-4738630 GCCACAGACATCGTCTCCCCAGG - Intronic
950676029 3:14555039-14555061 CCCCCAGGCTGTGTGACCCCAGG - Intergenic
950884889 3:16354510-16354532 CCCCCAGGCATTGACACTCCAGG + Intronic
952907488 3:38151662-38151684 GCACCAGGCTTTGTGACCCAAGG + Intergenic
953029213 3:39166686-39166708 GCCCCAGGCATGGTCAACTTAGG + Intergenic
954325228 3:49859778-49859800 GCCACAGACACTGCCACCCCCGG - Exonic
955324694 3:58000874-58000896 GCCCCAGGAGTCCTCACCCCAGG - Intergenic
958806539 3:98817878-98817900 TCCCCAGGCATTATAACCACTGG - Exonic
961353214 3:126316824-126316846 GCCCCAGGCAGTGCCAGCCACGG - Intergenic
964277036 3:155019899-155019921 GCCAGAGGCATAGTCACCCAGGG + Intergenic
964985379 3:162732085-162732107 GCTCCAGGCTTTGTGACTCCAGG - Intergenic
965367701 3:167820541-167820563 GCCCCAGGCATGTGCACACCCGG - Intronic
967388637 3:188933609-188933631 CTCCCAGGCATTGCCAGCCCAGG - Intergenic
968057756 3:195705683-195705705 GACCCAGGTGTTGTCACCCCAGG - Intergenic
968568890 4:1329082-1329104 GCCCCGGCCACTGTCAGCCCTGG + Intronic
968944886 4:3658400-3658422 GCCCCAGGCACTGCGACCCTGGG - Intergenic
969373147 4:6746854-6746876 GCCCCAGGCAATGGGGCCCCAGG + Intergenic
969684257 4:8661059-8661081 ACCCCAGGCTCTGCCACCCCTGG - Intergenic
972496775 4:39641526-39641548 CCCCCAGTGATTGTCACCGCTGG + Intergenic
977902657 4:102440088-102440110 AACCCAGGCATTGTCAAGCCTGG + Intergenic
978522541 4:109631723-109631745 CCACCATGCATTGTCTCCCCAGG - Intronic
979240458 4:118442786-118442808 GTCCCCTGCTTTGTCACCCCTGG - Intergenic
983016578 4:162620992-162621014 GGCCCAGGGATTGGGACCCCTGG - Intergenic
984734508 4:183098133-183098155 GCACCCGGCATTGTCCCGCCTGG + Intergenic
994251576 5:97542292-97542314 GCCCCAGCCTTGGTCATCCCAGG + Intergenic
994450081 5:99930066-99930088 GCCCCATGCAGTGGCACCCAAGG + Intergenic
995795693 5:115939252-115939274 CTTCCAGGCATTGCCACCCCTGG + Intergenic
996729448 5:126703270-126703292 GCTCCAGGCTTTGTGACTCCAGG + Intergenic
999111677 5:149126907-149126929 AACCCAGGCAGTGTGACCCCAGG + Intergenic
999259721 5:150230543-150230565 GGCCCAGGCCTTGTCAGCACTGG + Intronic
1002106113 5:176880113-176880135 GCTCCAGGCACTGTCCCTCCTGG - Exonic
1002570747 5:180138012-180138034 GCCTCCGACATGGTCACCCCAGG - Exonic
1002740713 5:181433365-181433387 GTCCCCTGCTTTGTCACCCCTGG - Intergenic
1002898554 6:1392878-1392900 GCCCGAGCTATTGTCTCCCCCGG - Intronic
1004131771 6:12927701-12927723 GCCCCAGGCATTGTCATCACGGG - Intronic
1006739057 6:36294369-36294391 GACCCACGCATTGTTCCCCCCGG + Exonic
1007525893 6:42493179-42493201 GCCCCTGGCATTTTCACTTCTGG + Intergenic
1008668128 6:53737855-53737877 AACCCAGGCAGTTTCACCCCAGG + Intergenic
1019121433 6:169808205-169808227 ACCCCCGGCACTGGCACCCCCGG + Intergenic
1019170549 6:170131060-170131082 GCTCCAGGCCTTGGCACCCCCGG + Intergenic
1019245822 6:170708961-170708983 GTCCCCTGCTTTGTCACCCCTGG - Intergenic
1019558551 7:1644714-1644736 GGTCCAGGCATGGTGACCCCAGG + Intergenic
1021873633 7:25028410-25028432 GCTCCAGGCACTGCCTCCCCAGG - Intergenic
1023871817 7:44267241-44267263 GCCCCAGGGACTGTCTGCCCTGG - Intronic
1024230608 7:47360721-47360743 GCACCAGGCATAGACACTCCTGG - Intronic
1026932819 7:74233924-74233946 TTCCCAGGCAATTTCACCCCTGG + Intronic
1027251243 7:76400150-76400172 GCACCAGGCATTGTAGCCTCTGG + Intronic
1029658745 7:101945023-101945045 TTCCCAGAAATTGTCACCCCAGG + Intronic
1035502301 8:99237-99259 GTCCCCTGCTTTGTCACCCCTGG + Intergenic
1035591873 8:822368-822390 GCCCCAGGAACACTCACCCCCGG - Intergenic
1036734610 8:11300016-11300038 CCCCCAGGCATTGTCTACTCTGG + Exonic
1037174002 8:15925969-15925991 GCTCCAGGCTTTGTGACTCCAGG - Intergenic
1045347296 8:101304669-101304691 ACACCAGGCATTGTAACACCAGG + Intergenic
1046294659 8:112201903-112201925 GCTCCAGGCTTTGTGACTCCAGG - Intergenic
1046395345 8:113633074-113633096 ACCCCGGGCACTGTCACGCCTGG - Intergenic
1049763936 8:144344182-144344204 GCCCCAGGAATTGTTCCTCCGGG + Intergenic
1051694568 9:19754226-19754248 GCCCCACTCATTGCCTCCCCAGG + Intronic
1052865725 9:33463670-33463692 TCCCCAGGCTCTGCCACCCCAGG + Intronic
1053788793 9:41671320-41671342 GACCCAGGCATTATTTCCCCAGG + Intergenic
1054156347 9:61643448-61643470 GACCCAGGCATTATTTCCCCAGG - Intergenic
1054177074 9:61882659-61882681 GACCCAGGCATTATTTCCCCAGG + Intergenic
1054476119 9:65574458-65574480 GACCCAGGCATTATTTCCCCAGG - Intergenic
1054660460 9:67698147-67698169 GACCCAGGCATTATTTCCCCAGG - Intergenic
1055890969 9:81122945-81122967 GCCCCAAGCATAGACACACCTGG + Intergenic
1056766932 9:89450015-89450037 GCCCCATGCCTGGTCACACCTGG + Intronic
1057885639 9:98827628-98827650 GCCCTAGGCATTGTTCCTCCTGG - Intronic
1058485088 9:105435643-105435665 GCTCCAGGCTTTGTGACTCCAGG + Intronic
1058731564 9:107855131-107855153 GGCCCAGGCATTGACAACACAGG + Intergenic
1058800821 9:108543090-108543112 GCCCCAGGGATCGGCAGCCCAGG + Intergenic
1060559042 9:124527801-124527823 GCCCCAGGCTAGGCCACCCCAGG + Intronic
1061194887 9:129102269-129102291 GCCCCAGGAATGGGCGCCCCTGG - Intronic
1062084770 9:134642784-134642806 CCCCCAGGCACTGTCACTCTAGG + Intronic
1062543512 9:137051891-137051913 GCCCTGGGCATGGTCAACCCAGG + Intronic
1203606021 Un_KI270748v1:58172-58194 GTCCCCTGCTTTGTCACCCCTGG - Intergenic
1185779186 X:2829997-2830019 GGCCCCGCCAGTGTCACCCCCGG - Intronic
1186795646 X:13044418-13044440 GGCCCAGGCATTGTCGCCTGGGG - Intronic
1188190534 X:27166740-27166762 AACCCAGGCATTCTCATCCCTGG + Intergenic
1188881426 X:35496773-35496795 GCTCCAGGCTTTGTGACTCCAGG - Intergenic
1189904404 X:45743058-45743080 GCCCCAGGCCTTGGCACTCCGGG - Intergenic
1192152228 X:68719451-68719473 TCCCCAGGCAGGGTCAGCCCAGG + Intronic
1197853405 X:130889144-130889166 GCCCCAGGTGTGGCCACCCCAGG - Intronic
1198325489 X:135567424-135567446 GACTAAGGCAGTGTCACCCCAGG + Intronic
1200061648 X:153486398-153486420 GCCCCAGCCCTTGTCGCTCCAGG - Intronic
1200084166 X:153595056-153595078 GCCCCGGGCATTGCCACCTCAGG - Intronic
1202388187 Y:24344609-24344631 GTCCCCTGCTTTGTCACCCCTGG - Intergenic
1202482600 Y:25325519-25325541 GTCCCCTGCTTTGTCACCCCTGG + Intergenic