ID: 1181317832

View in Genome Browser
Species Human (GRCh38)
Location 22:21982438-21982460
Sequence CACCCTAAAGAGCTGTGGGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 192}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181317826_1181317832 7 Left 1181317826 22:21982408-21982430 CCCTACCTGTGAGACTGGTACAG 0: 1
1: 0
2: 0
3: 10
4: 96
Right 1181317832 22:21982438-21982460 CACCCTAAAGAGCTGTGGGAGGG 0: 1
1: 0
2: 2
3: 17
4: 192
1181317822_1181317832 23 Left 1181317822 22:21982392-21982414 CCCTGAGCCTCAGTTTCCCTACC 0: 2
1: 28
2: 167
3: 701
4: 2054
Right 1181317832 22:21982438-21982460 CACCCTAAAGAGCTGTGGGAGGG 0: 1
1: 0
2: 2
3: 17
4: 192
1181317827_1181317832 6 Left 1181317827 22:21982409-21982431 CCTACCTGTGAGACTGGTACAGC 0: 1
1: 0
2: 0
3: 7
4: 87
Right 1181317832 22:21982438-21982460 CACCCTAAAGAGCTGTGGGAGGG 0: 1
1: 0
2: 2
3: 17
4: 192
1181317823_1181317832 22 Left 1181317823 22:21982393-21982415 CCTGAGCCTCAGTTTCCCTACCT 0: 1
1: 30
2: 236
3: 854
4: 2525
Right 1181317832 22:21982438-21982460 CACCCTAAAGAGCTGTGGGAGGG 0: 1
1: 0
2: 2
3: 17
4: 192
1181317824_1181317832 16 Left 1181317824 22:21982399-21982421 CCTCAGTTTCCCTACCTGTGAGA 0: 1
1: 6
2: 86
3: 716
4: 3404
Right 1181317832 22:21982438-21982460 CACCCTAAAGAGCTGTGGGAGGG 0: 1
1: 0
2: 2
3: 17
4: 192
1181317828_1181317832 2 Left 1181317828 22:21982413-21982435 CCTGTGAGACTGGTACAGCAGAT 0: 1
1: 0
2: 4
3: 15
4: 130
Right 1181317832 22:21982438-21982460 CACCCTAAAGAGCTGTGGGAGGG 0: 1
1: 0
2: 2
3: 17
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181317832 Original CRISPR CACCCTAAAGAGCTGTGGGA GGG Exonic
900124312 1:1062760-1062782 CAGCCTCCAGAGCTGAGGGAAGG - Intergenic
900383407 1:2397144-2397166 CACCCTACACGGCTGTGCGATGG + Exonic
900946094 1:5832238-5832260 CTCCCTAGATAGCTGTGGGCTGG + Intergenic
901145591 1:7062579-7062601 CGCGCTAAGGAGCTGTGGGGTGG + Intronic
901493968 1:9610821-9610843 CACCCCAAGGGGCCGTGGGAGGG + Intronic
902561635 1:17281152-17281174 CACCCTAAATACATGTGGGATGG - Intronic
902687325 1:18086920-18086942 CTCACTGGAGAGCTGTGGGATGG + Intergenic
903071944 1:20731108-20731130 CACCCTACTTATCTGTGGGAGGG - Intronic
903999778 1:27332319-27332341 AAACCTGAAGAGCTGTGGCAAGG - Intronic
905395990 1:37666960-37666982 CACCCTGGCGAGCTCTGGGAGGG + Intergenic
906037196 1:42758644-42758666 CAACCCAAAAAGCTGGGGGAGGG - Intronic
910804421 1:91176468-91176490 CTCCCTAAGGAGCTTGGGGAGGG - Intergenic
911181494 1:94864451-94864473 CACCCTAAAGGGTTGGTGGATGG + Intronic
911247391 1:95533923-95533945 CACCTTGAGGTGCTGTGGGAAGG + Intergenic
913701911 1:121382486-121382508 CACCCTAGAGGGCTGTGAGGTGG - Intronic
914042468 1:144062955-144062977 CACCCTACAGGGCTGTGAGGTGG - Intergenic
914135619 1:144897533-144897555 CACCCTACAGGGCTGTGAGGTGG + Intronic
920489334 1:206401206-206401228 CACCCTAGAGGGCTGTGAGGCGG - Intronic
920503087 1:206497671-206497693 CACTCTAAAGGCCTGGGGGAAGG + Exonic
920751144 1:208678562-208678584 CACCATGAAGAACAGTGGGAAGG + Intergenic
921050333 1:211506467-211506489 GACCCTAAAGAAGTGAGGGAGGG - Intergenic
921150553 1:212398991-212399013 CAAGCTAAATAGCTGTGGGTAGG - Intronic
921315728 1:213888403-213888425 CAACCCAATGAGTTGTGGGAGGG + Intergenic
923814283 1:237358388-237358410 CACTCTCAGGTGCTGTGGGAAGG + Intronic
923823804 1:237476971-237476993 CACCCTAAAGGGCTATGCAAAGG - Intronic
1064758755 10:18597467-18597489 CACCCTCAAGAACTGTGAGATGG + Intronic
1067050103 10:43010845-43010867 AACCCATAAGAGCTGTGGCATGG + Intergenic
1072293025 10:93982946-93982968 AAGCCTAAATAGGTGTGGGAAGG + Intergenic
1075194968 10:120348405-120348427 CAGCCTTCAGAGCAGTGGGAGGG - Intergenic
1075415323 10:122258459-122258481 AACCCTAAAGGGCTGTGTCAAGG + Intergenic
1077465477 11:2731780-2731802 CACCCGGAAGAGCTGGGAGATGG - Intronic
1078457083 11:11483740-11483762 GACGCTAATGAGCTGTGGGAGGG + Intronic
1079252255 11:18794788-18794810 CATCTTAAAGGGCTATGGGAAGG + Intergenic
1079504755 11:21141322-21141344 AAACCTACAGAGCTGAGGGAAGG - Intronic
1082899120 11:58226952-58226974 CTCCCATAAGAGCTGAGGGAGGG - Intergenic
1084865711 11:72055274-72055296 CACCTTAAACAGCTGTTGTAAGG - Intronic
1085458960 11:76681646-76681668 CATCCCAACGTGCTGTGGGAGGG - Intergenic
1086368336 11:86131399-86131421 CACTCTAAATATTTGTGGGATGG + Intergenic
1086577526 11:88357075-88357097 CACCTTAAAGAGCTGTTGTCAGG + Intergenic
1089898879 11:121960686-121960708 CACTCTTAAGGGCTGTGGGGAGG + Intergenic
1091321164 11:134652975-134652997 CACTCTCAAGGGTTGTGGGAAGG - Intergenic
1092372605 12:7929756-7929778 CACTCTAAAGAGCTCTAGCACGG + Exonic
1094404811 12:30106256-30106278 CACCCTAATCAGCTGTGACAGGG + Intergenic
1096994815 12:55831794-55831816 CACCCTGAAGAGCTGCAGGGTGG + Intergenic
1097325695 12:58273933-58273955 CAACTTAAAGAGCTCTGAGAGGG - Intergenic
1097447105 12:59684858-59684880 CCCCCTAAAGACCTGTAGGCTGG - Intronic
1097747737 12:63318059-63318081 CACCCAAAAGAGAGGTGGCAGGG + Intergenic
1098897696 12:76083151-76083173 TGCCCTAAAGATCTGGGGGATGG - Intronic
1100072313 12:90735733-90735755 CATCCTAGAGACCTGTTGGATGG - Intergenic
1100353011 12:93802572-93802594 CAAGCTCAAGAGGTGTGGGATGG + Intronic
1101064108 12:101001733-101001755 CACCCTGAGCAGCTGGGGGAGGG + Intronic
1101112217 12:101497112-101497134 CCACCTACAGACCTGTGGGAAGG + Intergenic
1102148197 12:110670368-110670390 CCCCCAAAATAGCTCTGGGAGGG - Intronic
1102879487 12:116473469-116473491 CACCCTACAGAGCAGCTGGAGGG + Intergenic
1103061663 12:117863277-117863299 CACCCTAAAGAGCTGCCAGGTGG + Intronic
1104833178 12:131768738-131768760 GACTCTGAAGAGCTGTGGAAAGG - Intronic
1104845254 12:131843733-131843755 CACCCTAAAGAGCTGAAGACAGG - Intronic
1111926582 13:94469558-94469580 CATCCTCCAGAACTGTGGGAGGG + Intronic
1114447315 14:22798950-22798972 CACCCACGAGAGCTGTGTGAGGG + Intronic
1115656209 14:35446061-35446083 CACCCAGAAGAGCTGTGGTTTGG + Intergenic
1116752074 14:48899213-48899235 CATCCTCCAGAGCTGTGAGATGG - Intergenic
1118979825 14:70707361-70707383 CAAGCTCAAGAGGTGTGGGAGGG + Intergenic
1119960742 14:78853731-78853753 GAACCTGAAGAGCTGTGGGTTGG - Intronic
1120901305 14:89578039-89578061 AGCCCTGAAGAGCTGTGGGTTGG - Intronic
1121073682 14:91048780-91048802 AATCCTAAAGTGCTGTGGGAGGG - Intronic
1121707636 14:96010960-96010982 CACCCAGTGGAGCTGTGGGAAGG - Intergenic
1123465106 15:20509277-20509299 AACTCTAAAGAACAGTGGGAAGG + Intergenic
1123653011 15:22491752-22491774 AACTCTAAAGAACAGTGGGAAGG - Intergenic
1123743432 15:23300615-23300637 AACTCTAAAGAACAGTGGGAAGG - Intergenic
1124207138 15:27730607-27730629 GACCCTAGATAGCTGTAGGATGG - Intergenic
1124275831 15:28325256-28325278 AACTCTAAAGAACAGTGGGAAGG + Intergenic
1124292302 15:28464196-28464218 AACTCTAAAGAACAGTGGGAAGG - Intergenic
1124306871 15:28586345-28586367 AACTCTAAAGAACAGTGGGAAGG - Intergenic
1125519546 15:40340277-40340299 CTCCCTGGAGAGCTGGGGGAGGG - Intronic
1126348757 15:47722869-47722891 CACCTTACAGAGCTGTCTGAGGG - Intronic
1127354982 15:58189440-58189462 CACCCGAAAGAGGTGGGGTAGGG - Intronic
1131469830 15:92687094-92687116 CACCCTGAAGAGTTGTAGGCAGG - Intronic
1132896138 16:2230270-2230292 CTCCCTGATGTGCTGTGGGAGGG + Intronic
1133343346 16:5053495-5053517 CACCCTATAGTGCTATGGAACGG - Intronic
1134033250 16:11009524-11009546 CAGCCTCATGAGCTGTGGGATGG + Intronic
1136013354 16:27379189-27379211 CACCTTAGGGACCTGTGGGACGG - Intergenic
1137659697 16:50193929-50193951 CACCCCACAGAGCTGTGGAGTGG + Intronic
1139252361 16:65508583-65508605 CACCCTTAAGAGCGATGGGAGGG - Intergenic
1141621990 16:85241267-85241289 CACCCTAGAGGGCTGTGGTGAGG + Intergenic
1143836905 17:9700107-9700129 AGCCCTGAAGAGCTGTGGGAAGG + Intronic
1145251934 17:21301522-21301544 CCCCTCAAAGAGCTGTGGCAGGG + Intronic
1147183809 17:38703183-38703205 CACCCTAAAACGGTGTGGGGAGG + Intergenic
1147262057 17:39214491-39214513 CACCCCAAAGCGCACTGGGACGG + Intronic
1147266214 17:39236547-39236569 CACCCTCAAGACCTTGGGGAGGG - Intergenic
1147468144 17:40628445-40628467 CACCCCAGTGAGCTGTAGGAAGG + Exonic
1151472277 17:74325919-74325941 CTCCCTAAAGGGCAGTGGCACGG + Intergenic
1152704798 17:81837639-81837661 CAGCCTCCAGAGCTCTGGGACGG - Intergenic
1157631121 18:49096975-49096997 CACCGCAAAGGGCTGTGGTAGGG + Intronic
1157660781 18:49441755-49441777 CACCCCATGGAGCCGTGGGAAGG + Intronic
1159031752 18:63238952-63238974 GCCCCTGGAGAGCTGTGGGATGG + Intronic
1160165110 18:76504238-76504260 CAACAGAAAGAGCTGCGGGACGG + Intergenic
1165375505 19:35438950-35438972 CACCCCGAAAAGCTGTGGCAAGG - Intergenic
1166853955 19:45773193-45773215 CACCCCACTCAGCTGTGGGAAGG + Intronic
1168408053 19:56120958-56120980 CGCGCCGAAGAGCTGTGGGAGGG - Intronic
929277433 2:40041512-40041534 CAATCTAAAGAGCCGTGGGGTGG - Intergenic
929388788 2:41443244-41443266 CACCCTCAACAGCTGTGGGATGG - Intergenic
929471472 2:42198355-42198377 CACTCTAAAGCACTGGGGGAAGG + Intronic
929489638 2:42384865-42384887 CACCTTGCAGAGCTGGGGGAAGG - Intronic
929798854 2:45082558-45082580 CACCCTTAAGAGCAAGGGGAGGG + Intergenic
929994796 2:46818514-46818536 CTCCCTGTAGGGCTGTGGGAGGG + Intronic
932794851 2:74685477-74685499 TACCCTACAGAGCTGAGAGAAGG - Intergenic
934956225 2:98622568-98622590 CGCCCTTAAGAGCAGTGTGAGGG - Exonic
935830607 2:106997553-106997575 CACCATGGAAAGCTGTGGGAGGG + Intergenic
935889611 2:107662102-107662124 CAACCCAAAGAGGGGTGGGAGGG + Intergenic
936017692 2:108972133-108972155 GACCCTCAAAATCTGTGGGATGG + Intronic
936054735 2:109253929-109253951 CAGCCTTAAGAGCTGTGGAAGGG - Intronic
937096111 2:119236282-119236304 CACCTTAATGAGGTGTGGCAAGG - Intronic
937359782 2:121220674-121220696 GACCCTGGACAGCTGTGGGAAGG + Exonic
939827494 2:147032339-147032361 CACCCAAAAGTGGTCTGGGATGG - Intergenic
942781597 2:179649431-179649453 CACCCTGGAGCGCTGTGGTATGG - Intronic
943533466 2:189116564-189116586 CAGCCTCAAGATCTATGGGATGG + Intronic
945669159 2:212781671-212781693 CAACCATAAGAGCTGTGGCAAGG + Intergenic
947821620 2:233075358-233075380 CACCACAAAGAGCTGGGGAAGGG + Intronic
948248808 2:236508414-236508436 CCCCCTGAAGGGCTTTGGGAGGG - Intergenic
1168908028 20:1422473-1422495 CACCTTAGAGAGCTGTTGCAAGG - Intergenic
1171992249 20:31705652-31705674 CACCCTAAAGGGATCTGAGAAGG + Intronic
1174401552 20:50278602-50278624 CACCCGAAGGAGTTGTGGGAGGG - Intergenic
1175308974 20:57998321-57998343 CACCTTACAGAGCTGTGTGTGGG + Intergenic
1175319712 20:58076602-58076624 CACCCCACCCAGCTGTGGGAGGG - Intergenic
1177031679 21:15987979-15988001 CACCATTTAGAACTGTGGGATGG - Intergenic
1177684621 21:24419693-24419715 CACCCTAGAGACCTGTTGAATGG - Intergenic
1179612175 21:42559486-42559508 CACGCTCAAGGCCTGTGGGAGGG - Intronic
1180230084 21:46421923-46421945 CCCCCTGGAGAGCTGTGGGTGGG + Intronic
1181317832 22:21982438-21982460 CACCCTAAAGAGCTGTGGGAGGG + Exonic
1181487915 22:23243218-23243240 GCCCCTAGATAGCTGTGGGACGG + Intronic
1183742479 22:39676593-39676615 CTCCCACAGGAGCTGTGGGATGG + Intronic
952447224 3:33393078-33393100 CATCCTAAAGGGCTGGGGGGAGG + Intronic
953792034 3:45954899-45954921 CAGCCTCCAGAGCTGTGAGAAGG + Intronic
956308200 3:67849769-67849791 CACCCTAAAGGAATATGGGAAGG + Intergenic
957737528 3:84221857-84221879 GACCCTAAAGAGCTTCAGGATGG - Intergenic
961493433 3:127273659-127273681 CACCCGGAAGACATGTGGGATGG + Intergenic
961821327 3:129577176-129577198 CACCCTGGGGAGCTCTGGGACGG - Intronic
961907764 3:130280297-130280319 CCCCATAAGCAGCTGTGGGATGG - Intergenic
962168975 3:133080543-133080565 CTGACTAAAGAGCTCTGGGAAGG - Intronic
966040297 3:175476775-175476797 TACCCTAAAGAATTGTGGCATGG - Intronic
970968443 4:21953884-21953906 CAGCCTGCAGAACTGTGGGAAGG + Intergenic
972115533 4:35628722-35628744 CACCCTAGTGAGAGGTGGGAAGG - Intergenic
972676826 4:41268066-41268088 CAGCCTAATGCTCTGTGGGAGGG + Exonic
973301328 4:48588397-48588419 CACATTAAAGAACTGGGGGATGG - Intronic
973346129 4:49057920-49057942 TAACCAAAAGAGATGTGGGATGG - Intronic
976914545 4:90354884-90354906 CACCACAAAGAGCACTGGGAAGG - Intronic
979219787 4:118210014-118210036 CACCAAAATGAGCTGTGAGAGGG + Intronic
980629158 4:135410925-135410947 CACCCTAAAGTGTCTTGGGATGG - Intergenic
982482270 4:155926781-155926803 CACCCTTAGTAGCTGAGGGATGG + Intronic
983068750 4:163243743-163243765 CAGCCCAATGAGTTGTGGGAAGG + Intergenic
983354467 4:166638015-166638037 CACCCCAAAGAGCTGTGGCATGG - Intergenic
983693209 4:170497734-170497756 CACCCTGTAGGGCTGTGGAAAGG + Intergenic
986709874 5:10480883-10480905 CACTGGAAAGAGCTGTGGGTGGG - Intergenic
987104136 5:14620422-14620444 CACATTAAATAACTGTGGGAAGG + Intergenic
991207300 5:64064731-64064753 CACCCTAAAGAGAGTTGGGAGGG - Intergenic
991274267 5:64825214-64825236 CAATGGAAAGAGCTGTGGGAGGG + Intronic
991937822 5:71819152-71819174 TACCTCAAAGAGCTGTTGGATGG + Intergenic
994710187 5:103256902-103256924 AACACTAAAAAGCTCTGGGAAGG + Intergenic
995723977 5:115166085-115166107 CACCATGAACAGCAGTGGGAGGG + Intronic
996402131 5:123074138-123074160 GACTCCAAAGAGCTGTGTGAGGG + Intergenic
997661120 5:135590334-135590356 AACCCTGAAGAGCTGGAGGAGGG + Intergenic
999868196 5:155724736-155724758 CACTCTAAAGTGCTATTGGATGG + Intergenic
1000042135 5:157492793-157492815 CACCCCAGAGAACTGTCGGAAGG - Intronic
1001042813 5:168348968-168348990 CACCTCACAGAGCTGTGGGGAGG - Intronic
1001427432 5:171632728-171632750 GATCCTAAAGGGCTGTGGGAGGG - Intergenic
1003499640 6:6694003-6694025 GACCCTCAAGAGCTATGGGGGGG - Intergenic
1004574545 6:16882535-16882557 AACCCAAAAGACCTGGGGGAAGG - Intergenic
1006437353 6:34032938-34032960 CTCCCTGAGGAGGTGTGGGAAGG + Intronic
1007914797 6:45551514-45551536 AACCCAAAAGAGATGTGGAAAGG - Intronic
1011103989 6:83758572-83758594 TACCCTCAGGATCTGTGGGAGGG + Intergenic
1015688790 6:135896895-135896917 CACACTGAAGAGATGGGGGATGG - Intronic
1017910519 6:158788337-158788359 CACCCAAAAGGGATGGGGGAAGG + Intronic
1018548298 6:164962816-164962838 CTGCCTATGGAGCTGTGGGAAGG + Intergenic
1019334840 7:478271-478293 CACCCTTCAGGGCTATGGGAAGG + Intergenic
1019422952 7:959480-959502 CACCCACCAGCGCTGTGGGAGGG - Intronic
1024278455 7:47698214-47698236 CACCTTAAAGAGATTTGGGATGG - Intronic
1026760231 7:73121186-73121208 CACCCTATAGAGTTGTTGGAAGG - Intergenic
1026853955 7:73741088-73741110 CGCCCTAAGGAGGTGGGGGAGGG - Intergenic
1027036573 7:74930007-74930029 CACCCTATAGAGTTGTTGGAAGG - Intergenic
1027086988 7:75271455-75271477 CACCCTATAGAGTTGTTGGAAGG + Intergenic
1029393291 7:100289446-100289468 CACTCTATAGAGTTGTTGGAAGG + Intergenic
1030415396 7:109237561-109237583 CTTCCTAGAGACCTGTGGGATGG + Intergenic
1030671958 7:112347779-112347801 AACCTTAAATAACTGTGGGAAGG - Intergenic
1036935936 8:13002932-13002954 CACCCTGAGGAGCTGGGGAAGGG - Intronic
1037405779 8:18541006-18541028 CACCTGAAAGAGGTGAGGGAGGG - Intronic
1038165692 8:25083227-25083249 CACCCTCAAGTGGGGTGGGAGGG + Intergenic
1039478274 8:37853049-37853071 CCCACTAAAGAGTGGTGGGAAGG - Intergenic
1040645240 8:49389426-49389448 CACCCACAGGAGCTGTGAGAGGG + Intergenic
1041888275 8:62838991-62839013 CACCCTGGAGAGCTGTGGAATGG - Intronic
1044259281 8:90098547-90098569 CACCCTAGAGGGCTGCAGGAAGG - Intergenic
1045401016 8:101817908-101817930 CTCCCAAAACAGCTGCGGGAAGG + Intronic
1049332345 8:142061365-142061387 CAGCCTCCAGAGTTGTGGGAGGG + Intergenic
1056203138 9:84295720-84295742 GACCACAAAGAGCTGTGGGCTGG + Intronic
1057003760 9:91537277-91537299 AACCTTAAAGAGCTGAGAGATGG + Intergenic
1057495062 9:95553984-95554006 CAGCCTCCAGAGCTGTGAGAGGG + Intergenic
1058598545 9:106644079-106644101 CTACCTAGAGAGCTGTGGGAGGG - Intergenic
1059493591 9:114690658-114690680 CCTCCTAAGAAGCTGTGGGAGGG + Intergenic
1059703219 9:116795832-116795854 AACCCTGAAGAGCTTTGGCAAGG - Intronic
1060496160 9:124120278-124120300 CACACTCACGTGCTGTGGGAGGG + Intergenic
1060679285 9:125546954-125546976 CAGCCCAAGGAGCCGTGGGAAGG - Intronic
1061242314 9:129381820-129381842 CTCAGTAAAGATCTGTGGGATGG + Intergenic
1061667472 9:132168925-132168947 CACCCTAGACAGCTTTGGCAAGG - Intronic
1061877935 9:133554270-133554292 CACCCTGCAGCTCTGTGGGAAGG + Intronic
1061967955 9:134026472-134026494 CACCCGGAAGAGCTGTGGCCGGG + Intergenic
1062085010 9:134643845-134643867 CACCCTAGACAGCTGGGGCAGGG + Intronic
1190381763 X:49845958-49845980 CAGCCTATGGAGATGTGGGATGG - Intergenic
1193254844 X:79335815-79335837 CAACCTAAAGAGCTTTTGTACGG - Intergenic
1195548138 X:106136830-106136852 AACCCAAAAGAGCAGAGGGAAGG + Intergenic
1197009827 X:121546767-121546789 CACCCTGAAGTGCTTTGGAAAGG - Intergenic
1198042913 X:132872029-132872051 CCCCCTAAAAAGGTGTTGGAAGG - Intronic
1200216334 X:154369666-154369688 CCCCCTAAAGAGCTGGGGTGTGG + Intronic
1201592270 Y:15628318-15628340 CTCCCTAAAGAGTTGTTGAATGG + Intergenic