ID: 1181318268

View in Genome Browser
Species Human (GRCh38)
Location 22:21985225-21985247
Sequence AGAGGAACCCTTCAACTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181318262_1181318268 5 Left 1181318262 22:21985197-21985219 CCCTTAGGTTGACAAATGACCCA No data
Right 1181318268 22:21985225-21985247 AGAGGAACCCTTCAACTTGGAGG No data
1181318263_1181318268 4 Left 1181318263 22:21985198-21985220 CCTTAGGTTGACAAATGACCCAG No data
Right 1181318268 22:21985225-21985247 AGAGGAACCCTTCAACTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181318268 Original CRISPR AGAGGAACCCTTCAACTTGG AGG Intergenic
No off target data available for this crispr